Incidental Mutation 'R0024:Krt6a'
ID177916
Institutional Source Beutler Lab
Gene Symbol Krt6a
Ensembl Gene ENSMUSG00000058354
Gene Namekeratin 6A
SynonymsKrt2-6a, MK6a, mK6[a], Krt2-6c
MMRRC Submission 038319-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.328) question?
Stock #R0024 (G1)
Quality Score53
Status Validated
Chromosome15
Chromosomal Location101689910-101694307 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 101690715 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023788]
Predicted Effect probably benign
Transcript: ENSMUST00000023788
SMART Domains Protein: ENSMUSP00000023788
Gene: ENSMUSG00000058354

DomainStartEndE-ValueType
Pfam:Keratin_2_head 15 148 4.1e-36 PFAM
Filament 151 464 7.2e-178 SMART
low complexity region 483 551 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230205
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation exhibit delayed wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,433,385 D209V probably damaging Het
Bbx T A 16: 50,224,918 M427L probably benign Het
Btbd11 A G 10: 85,387,447 D40G unknown Het
Camk2d A G 3: 126,797,723 M281V probably benign Het
Chdh G A 14: 30,031,596 R154H possibly damaging Het
Emid1 A T 11: 5,143,869 W93R probably damaging Het
Grid2ip T A 5: 143,391,041 S947T probably damaging Het
Gstt4 T A 10: 75,817,204 M175L possibly damaging Het
Hectd4 C T 5: 121,308,576 T242I possibly damaging Het
Hfm1 T C 5: 106,856,924 K1179E probably benign Het
Kif13b A G 14: 64,750,273 I750V probably benign Het
Krt34 A T 11: 100,041,037 C119S probably benign Het
Myof G T 19: 37,915,740 T4N probably damaging Het
Olfr457 A G 6: 42,471,260 M306T probably benign Het
P3h3 T C 6: 124,857,458 Q77R probably benign Het
Picalm T C 7: 90,130,704 probably null Het
Plcb1 A G 2: 135,362,425 S900G probably benign Het
Prkd2 T C 7: 16,847,643 L141P probably damaging Het
Prpf31 C A 7: 3,636,659 probably null Het
Rgs5 T A 1: 169,676,892 V37D probably damaging Het
Slc24a2 T C 4: 87,028,240 probably benign Het
Ssh2 A T 11: 77,454,966 Q1259L possibly damaging Het
Sugct G A 13: 16,857,869 H433Y probably benign Het
Sycp2l A G 13: 41,141,788 I310M probably damaging Het
Utrn A G 10: 12,406,011 V3301A probably benign Het
Other mutations in Krt6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Krt6a APN 15 101692794 missense probably damaging 1.00
IGL00596:Krt6a APN 15 101694230 missense possibly damaging 0.53
PIT4468001:Krt6a UTSW 15 101693917 missense probably damaging 0.98
R0024:Krt6a UTSW 15 101690715 splice site probably benign
R0811:Krt6a UTSW 15 101692748 missense probably damaging 1.00
R0812:Krt6a UTSW 15 101692748 missense probably damaging 1.00
R0828:Krt6a UTSW 15 101693836 missense probably damaging 0.99
R0924:Krt6a UTSW 15 101690800 splice site probably benign
R1525:Krt6a UTSW 15 101694202 missense probably benign
R1591:Krt6a UTSW 15 101692357 splice site probably null
R1725:Krt6a UTSW 15 101692557 missense probably damaging 1.00
R1962:Krt6a UTSW 15 101691465 missense probably damaging 1.00
R2201:Krt6a UTSW 15 101693171 missense probably benign 0.41
R3024:Krt6a UTSW 15 101691289 missense probably benign 0.02
R3158:Krt6a UTSW 15 101691366 missense probably damaging 1.00
R5369:Krt6a UTSW 15 101692558 missense probably benign 0.06
R5637:Krt6a UTSW 15 101692279 missense probably benign 0.25
R6164:Krt6a UTSW 15 101692573 missense probably damaging 0.99
R6320:Krt6a UTSW 15 101692309 missense probably damaging 0.99
R6562:Krt6a UTSW 15 101691659 missense probably benign 0.36
R7267:Krt6a UTSW 15 101693854 missense not run
X0067:Krt6a UTSW 15 101693777 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GACCAGAGACAAGCTCTTGGTGAC -3'
(R):5'- GCTGAAGTGATGGCTGCCTAGTTC -3'

Sequencing Primer
(F):5'- TGGTGACAGAATTCACTGCC -3'
(R):5'- GATGGCTGCCTAGTTCTCACC -3'
Posted On2014-04-30