Incidental Mutation 'R0392:St8sia5'
ID177948
Institutional Source Beutler Lab
Gene Symbol St8sia5
Ensembl Gene ENSMUSG00000025425
Gene NameST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
SynonymsSiat8e, ST8SiaV
MMRRC Submission 038598-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0392 (G1)
Quality Score64
Status Validated
Chromosome18
Chromosomal Location77185853-77255450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 77254406 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 271 (V271M)
Ref Sequence ENSEMBL: ENSMUSP00000074764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075290] [ENSMUST00000079618]
Predicted Effect probably damaging
Transcript: ENSMUST00000075290
AA Change: V271M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000074764
Gene: ENSMUSG00000025425
AA Change: V271M

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 152 407 6.4e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079618
AA Change: V235M

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078566
Gene: ENSMUSG00000025425
AA Change: V235M

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 112 372 5.4e-79 PFAM
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.6%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that may be present in the Golgi apparatus. The encoded protein, which is a member of glycosyltransferase family 29, may be involved in the synthesis of gangliosides GD1c, GT1a, GQ1b, and GT3 from GD1a, GT1b, GM1b, and GD3, respectively. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik T C 16: 4,977,499 noncoding transcript Het
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
Bcan T A 3: 87,993,562 K455* probably null Het
Casp12 T A 9: 5,348,973 probably benign Het
Ccdc61 T C 7: 18,891,102 M504V probably benign Het
Cd53 A T 3: 106,763,276 V147E probably damaging Het
Cyp2b13 T C 7: 26,085,883 Y226H probably benign Het
Cyp2j7 T C 4: 96,199,434 D413G probably damaging Het
Dcbld1 T C 10: 52,317,134 I254T possibly damaging Het
Ddx39 T G 8: 83,721,737 M206R probably damaging Het
Dgki T A 6: 37,000,178 T666S probably damaging Het
Dnah7a C A 1: 53,504,198 C2271F probably damaging Het
Emilin3 A G 2: 160,910,879 probably benign Het
Epha4 T C 1: 77,506,973 K133R probably benign Het
Gm11146 T A 16: 77,597,166 probably benign Het
Ift88 A T 14: 57,496,160 probably benign Het
Ighv10-3 A G 12: 114,523,840 probably benign Het
Lamp5 T C 2: 136,060,897 S179P probably damaging Het
Map4 T C 9: 110,078,045 S788P probably damaging Het
Olfr1025-ps1 T A 2: 85,918,762 I279N possibly damaging Het
Otog T C 7: 46,250,075 W267R probably benign Het
Pafah1b2 T C 9: 45,968,853 I175M probably benign Het
Pcdhb12 A G 18: 37,436,958 K386E possibly damaging Het
Pcnt T C 10: 76,384,826 N2056S probably benign Het
Pold2 T C 11: 5,876,776 I53V possibly damaging Het
Rsf1 T A 7: 97,679,005 D1071E probably benign Het
Rtp3 A T 9: 110,989,553 M20K probably damaging Het
S1pr5 T A 9: 21,244,981 I50F probably damaging Het
Slc47a1 A G 11: 61,371,782 S94P probably damaging Het
Slitrk5 G A 14: 111,679,033 V30I probably benign Het
Sult2b1 G T 7: 45,733,638 T240N probably damaging Het
Other mutations in St8sia5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:St8sia5 APN 18 77254662 missense probably damaging 1.00
IGL01320:St8sia5 APN 18 77254622 missense probably damaging 1.00
IGL01682:St8sia5 APN 18 77248500 missense probably damaging 0.99
IGL01984:St8sia5 APN 18 77248461 missense probably benign 0.03
ANU22:St8sia5 UTSW 18 77254662 missense probably damaging 1.00
R0194:St8sia5 UTSW 18 77254724 missense probably benign 0.13
R0622:St8sia5 UTSW 18 77246113 missense probably damaging 1.00
R0696:St8sia5 UTSW 18 77254464 missense probably damaging 1.00
R1231:St8sia5 UTSW 18 77232806 missense probably damaging 0.97
R1559:St8sia5 UTSW 18 77211764 critical splice donor site probably null
R2058:St8sia5 UTSW 18 77254763 missense probably damaging 1.00
R2059:St8sia5 UTSW 18 77254763 missense probably damaging 1.00
R2268:St8sia5 UTSW 18 77232830 missense probably damaging 0.99
R4399:St8sia5 UTSW 18 77253018 missense probably damaging 1.00
R4926:St8sia5 UTSW 18 77254782 missense possibly damaging 0.84
R5986:St8sia5 UTSW 18 77254782 missense possibly damaging 0.84
R6301:St8sia5 UTSW 18 77246140 missense probably damaging 0.98
R7020:St8sia5 UTSW 18 77246180 missense probably damaging 0.97
R7087:St8sia5 UTSW 18 77254542 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CTCTGAGAAATGCCACCTTCCTGG -3'
(R):5'- TCTCCGAGGGCATAGCATGGAAAC -3'

Sequencing Primer
(F):5'- gtgggaggagaaggggg -3'
(R):5'- TAGCATGGAAACCCGGCTTG -3'
Posted On2014-05-06