Incidental Mutation 'R0023:Carmil3'
ID178060
Institutional Source Beutler Lab
Gene Symbol Carmil3
Ensembl Gene ENSMUSG00000022211
Gene Namecapping protein regulator and myosin 1 linker 3
SynonymsLrrc16b
MMRRC Submission 038318-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.587) question?
Stock #R0023 (G1)
Quality Score65
Status Validated
Chromosome14
Chromosomal Location55490651-55508272 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 55492876 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 15 (S15R)
Ref Sequence ENSEMBL: ENSMUSP00000154517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022821] [ENSMUST00000076236] [ENSMUST00000226757] [ENSMUST00000228877]
Predicted Effect probably benign
Transcript: ENSMUST00000022821
SMART Domains Protein: ENSMUSP00000022821
Gene: ENSMUSG00000022210

DomainStartEndE-ValueType
Pfam:adh_short 34 229 7.8e-54 PFAM
Pfam:KR 35 210 8.4e-14 PFAM
Pfam:adh_short_C2 39 276 7.9e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000076236
AA Change: S15R

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075587
Gene: ENSMUSG00000022211
AA Change: S15R

DomainStartEndE-ValueType
low complexity region 138 151 N/A INTRINSIC
internal_repeat_1 203 297 7.56e-6 PROSPERO
Blast:LRR 333 362 5e-10 BLAST
Blast:LRR 423 446 1e-5 BLAST
low complexity region 447 462 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
internal_repeat_1 496 593 7.56e-6 PROSPERO
Pfam:CARMIL_C 778 1065 5.3e-76 PFAM
low complexity region 1068 1117 N/A INTRINSIC
low complexity region 1137 1146 N/A INTRINSIC
low complexity region 1204 1216 N/A INTRINSIC
low complexity region 1318 1329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226388
Predicted Effect probably benign
Transcript: ENSMUST00000226446
Predicted Effect probably damaging
Transcript: ENSMUST00000226757
AA Change: S15R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000226902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227542
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228760
Predicted Effect probably damaging
Transcript: ENSMUST00000228877
AA Change: S15R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.202 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik A C 4: 144,528,997 D329A probably damaging Het
Abcc12 T A 8: 86,538,333 H661L probably damaging Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Acsbg2 C G 17: 56,847,710 A481P probably damaging Het
Aknad1 T A 3: 108,781,185 C610S probably benign Het
Ang4 G T 14: 51,764,403 Y29* probably null Het
Aqp11 A T 7: 97,726,689 I251N possibly damaging Het
Arid1a G T 4: 133,691,176 T1032K unknown Het
Atg16l1 T C 1: 87,789,465 V538A probably benign Het
Bbs1 C T 19: 4,906,014 A44T probably damaging Het
Bpifa3 A C 2: 154,138,150 H234P probably damaging Het
Btbd9 A T 17: 30,530,214 V42E probably damaging Het
Casp8ap2 A G 4: 32,640,185 D413G probably damaging Het
Cfap44 T A 16: 44,421,220 F651L probably benign Het
Clcn3 A T 8: 60,933,070 probably benign Het
Crip3 A G 17: 46,430,994 K136E probably damaging Het
Ctr9 G A 7: 111,043,947 A509T possibly damaging Het
D930020B18Rik T C 10: 121,689,821 S367P probably damaging Het
Dhrs11 A T 11: 84,823,150 L125H probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Efcab7 A T 4: 99,901,637 probably benign Het
Eif2ak4 A C 2: 118,462,721 S1253R probably damaging Het
Emc1 A G 4: 139,371,009 D767G probably damaging Het
Fads1 G A 19: 10,186,897 probably benign Het
Fbxw26 T C 9: 109,718,011 T449A probably benign Het
Frrs1 T C 3: 116,896,788 F27L probably damaging Het
Fry T C 5: 150,451,098 S2358P possibly damaging Het
Gas6 A C 8: 13,470,344 L448R probably damaging Het
Hikeshi T C 7: 89,920,204 probably benign Het
Ifngr1 C T 10: 19,609,449 R399* probably null Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Knl1 C T 2: 119,102,549 T2063I possibly damaging Het
Lyzl6 A G 11: 103,636,871 V9A probably benign Het
Macf1 A T 4: 123,488,314 probably benign Het
Myo6 T C 9: 80,283,534 V789A possibly damaging Het
Myo9b A T 8: 71,333,768 R693W probably damaging Het
Nasp A G 4: 116,605,771 probably benign Het
Nr1i3 T C 1: 171,217,331 F247L probably damaging Het
Plekhs1 T G 19: 56,478,516 S260A probably damaging Het
Rpl21-ps6 T C 17: 55,915,536 noncoding transcript Het
Rtcb A T 10: 85,949,451 probably benign Het
Sppl2a T A 2: 126,913,293 probably null Het
Suco A T 1: 161,845,585 probably null Het
Tnn T A 1: 160,104,928 T1075S probably benign Het
Traf3 T A 12: 111,243,478 C169* probably null Het
Ucp3 G T 7: 100,485,043 V288L probably benign Het
Ulk3 C A 9: 57,590,356 C4* probably null Het
Vmn1r73 A T 7: 11,757,070 T272S probably benign Het
Vmn2r115 G A 17: 23,346,278 E380K probably benign Het
Vmn2r3 T A 3: 64,275,366 N304I probably damaging Het
Xylt1 G T 7: 117,634,701 G485V probably damaging Het
Yars A G 4: 129,197,188 T130A probably benign Het
Zfp652 A T 11: 95,753,469 R205* probably null Het
Other mutations in Carmil3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Carmil3 APN 14 55498298 missense probably damaging 0.99
IGL00498:Carmil3 APN 14 55501895 critical splice donor site probably null
IGL01061:Carmil3 APN 14 55498630 missense possibly damaging 0.67
IGL01452:Carmil3 APN 14 55496058 missense probably damaging 0.99
IGL01606:Carmil3 APN 14 55493849 missense possibly damaging 0.83
IGL01633:Carmil3 APN 14 55494227 missense possibly damaging 0.84
IGL01977:Carmil3 APN 14 55493536 missense probably damaging 1.00
IGL02065:Carmil3 APN 14 55493822 splice site probably benign
IGL02160:Carmil3 APN 14 55493558 missense possibly damaging 0.70
IGL02491:Carmil3 APN 14 55504517 missense probably benign 0.00
IGL02567:Carmil3 APN 14 55498882 missense possibly damaging 0.93
IGL02629:Carmil3 APN 14 55499068 missense probably damaging 0.97
IGL02720:Carmil3 APN 14 55507410 missense probably damaging 0.97
IGL03100:Carmil3 APN 14 55494718 missense probably damaging 0.99
PIT4434001:Carmil3 UTSW 14 55494688 missense probably null 1.00
R0023:Carmil3 UTSW 14 55492876 missense probably damaging 1.00
R0027:Carmil3 UTSW 14 55494403 missense probably damaging 0.96
R0101:Carmil3 UTSW 14 55497755 splice site probably benign
R0321:Carmil3 UTSW 14 55502241 missense possibly damaging 0.63
R0370:Carmil3 UTSW 14 55495442 missense possibly damaging 0.82
R0465:Carmil3 UTSW 14 55499861 missense probably damaging 0.99
R0647:Carmil3 UTSW 14 55502435 critical splice donor site probably null
R1503:Carmil3 UTSW 14 55498280 missense probably damaging 0.96
R1635:Carmil3 UTSW 14 55496282 missense possibly damaging 0.91
R1715:Carmil3 UTSW 14 55504532 missense probably benign 0.02
R1923:Carmil3 UTSW 14 55502404 missense probably damaging 0.99
R1944:Carmil3 UTSW 14 55498630 missense probably damaging 0.97
R2513:Carmil3 UTSW 14 55503838 missense probably damaging 0.98
R2892:Carmil3 UTSW 14 55498313 missense probably damaging 0.96
R3433:Carmil3 UTSW 14 55507694 missense probably benign 0.05
R3552:Carmil3 UTSW 14 55507402 missense possibly damaging 0.86
R3783:Carmil3 UTSW 14 55496976 missense probably damaging 1.00
R3787:Carmil3 UTSW 14 55496976 missense probably damaging 1.00
R4181:Carmil3 UTSW 14 55503955 missense probably benign 0.10
R4285:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4420:Carmil3 UTSW 14 55493588 missense probably damaging 0.98
R4424:Carmil3 UTSW 14 55501471 missense probably benign
R4506:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4507:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4534:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4535:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4549:Carmil3 UTSW 14 55505664 splice site probably null
R4574:Carmil3 UTSW 14 55499476 utr 3 prime probably benign
R4783:Carmil3 UTSW 14 55501321 critical splice donor site probably null
R4784:Carmil3 UTSW 14 55501321 critical splice donor site probably null
R5146:Carmil3 UTSW 14 55497179 missense probably benign 0.02
R5279:Carmil3 UTSW 14 55501571 missense probably damaging 0.98
R5425:Carmil3 UTSW 14 55493877 missense probably benign 0.41
R5530:Carmil3 UTSW 14 55493624 missense probably damaging 0.98
R5534:Carmil3 UTSW 14 55494890 missense probably damaging 0.97
R5598:Carmil3 UTSW 14 55503999 frame shift probably null
R5772:Carmil3 UTSW 14 55493239 missense probably damaging 1.00
R5896:Carmil3 UTSW 14 55503999 frame shift probably null
R5931:Carmil3 UTSW 14 55498940 missense probably damaging 0.99
R6048:Carmil3 UTSW 14 55503845 missense probably benign 0.00
R6103:Carmil3 UTSW 14 55505427 missense probably benign 0.02
R6258:Carmil3 UTSW 14 55500432 missense probably damaging 1.00
R6260:Carmil3 UTSW 14 55500432 missense probably damaging 1.00
R6338:Carmil3 UTSW 14 55499849 missense possibly damaging 0.83
R6339:Carmil3 UTSW 14 55499849 missense possibly damaging 0.83
R6646:Carmil3 UTSW 14 55507930 missense probably damaging 0.97
R6936:Carmil3 UTSW 14 55501561 missense probably benign 0.04
R7164:Carmil3 UTSW 14 55501282 missense probably damaging 0.98
R7214:Carmil3 UTSW 14 55498612 missense probably damaging 1.00
R7223:Carmil3 UTSW 14 55496238 missense possibly damaging 0.48
R7269:Carmil3 UTSW 14 55493895 missense probably benign 0.03
R7319:Carmil3 UTSW 14 55494360 missense probably benign 0.13
R7386:Carmil3 UTSW 14 55497747 critical splice donor site probably null
U24488:Carmil3 UTSW 14 55497179 missense probably benign 0.02
Z1088:Carmil3 UTSW 14 55501568 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTGCCACTCAGCAACTGTC -3'
(R):5'- AACACTAACCCAGCCTGGTTCTGC -3'

Sequencing Primer
(F):5'- ACCAGGAGCCAGAGTTTTCTC -3'
(R):5'- TAGGTTTTGTCTCCTCAGCAC -3'
Posted On2014-05-07