Incidental Mutation 'R0023:Vmn2r115'
ID178062
Institutional Source Beutler Lab
Gene Symbol Vmn2r115
Ensembl Gene ENSMUSG00000091076
Gene Namevomeronasal 2, receptor 115
SynonymsEG638102
MMRRC Submission 038318-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R0023 (G1)
Quality Score36
Status Validated
Chromosome17
Chromosomal Location23343977-23360128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23346278 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 380 (E380K)
Ref Sequence ENSEMBL: ENSMUSP00000131447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168175]
Predicted Effect probably benign
Transcript: ENSMUST00000168175
AA Change: E380K

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131447
Gene: ENSMUSG00000091076
AA Change: E380K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 1.4e-28 PFAM
Pfam:NCD3G 512 565 2.9e-20 PFAM
Pfam:7tm_3 598 833 5e-55 PFAM
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik A C 4: 144,528,997 D329A probably damaging Het
Abcc12 T A 8: 86,538,333 H661L probably damaging Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Acsbg2 C G 17: 56,847,710 A481P probably damaging Het
Aknad1 T A 3: 108,781,185 C610S probably benign Het
Ang4 G T 14: 51,764,403 Y29* probably null Het
Aqp11 A T 7: 97,726,689 I251N possibly damaging Het
Arid1a G T 4: 133,691,176 T1032K unknown Het
Atg16l1 T C 1: 87,789,465 V538A probably benign Het
Bbs1 C T 19: 4,906,014 A44T probably damaging Het
Bpifa3 A C 2: 154,138,150 H234P probably damaging Het
Btbd9 A T 17: 30,530,214 V42E probably damaging Het
Carmil3 C G 14: 55,492,876 S15R probably damaging Het
Casp8ap2 A G 4: 32,640,185 D413G probably damaging Het
Cfap44 T A 16: 44,421,220 F651L probably benign Het
Clcn3 A T 8: 60,933,070 probably benign Het
Crip3 A G 17: 46,430,994 K136E probably damaging Het
Ctr9 G A 7: 111,043,947 A509T possibly damaging Het
D930020B18Rik T C 10: 121,689,821 S367P probably damaging Het
Dhrs11 A T 11: 84,823,150 L125H probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Efcab7 A T 4: 99,901,637 probably benign Het
Eif2ak4 A C 2: 118,462,721 S1253R probably damaging Het
Emc1 A G 4: 139,371,009 D767G probably damaging Het
Fads1 G A 19: 10,186,897 probably benign Het
Fbxw26 T C 9: 109,718,011 T449A probably benign Het
Frrs1 T C 3: 116,896,788 F27L probably damaging Het
Fry T C 5: 150,451,098 S2358P possibly damaging Het
Gas6 A C 8: 13,470,344 L448R probably damaging Het
Hikeshi T C 7: 89,920,204 probably benign Het
Ifngr1 C T 10: 19,609,449 R399* probably null Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Knl1 C T 2: 119,102,549 T2063I possibly damaging Het
Lyzl6 A G 11: 103,636,871 V9A probably benign Het
Macf1 A T 4: 123,488,314 probably benign Het
Myo6 T C 9: 80,283,534 V789A possibly damaging Het
Myo9b A T 8: 71,333,768 R693W probably damaging Het
Nasp A G 4: 116,605,771 probably benign Het
Nr1i3 T C 1: 171,217,331 F247L probably damaging Het
Plekhs1 T G 19: 56,478,516 S260A probably damaging Het
Rpl21-ps6 T C 17: 55,915,536 noncoding transcript Het
Rtcb A T 10: 85,949,451 probably benign Het
Sppl2a T A 2: 126,913,293 probably null Het
Suco A T 1: 161,845,585 probably null Het
Tnn T A 1: 160,104,928 T1075S probably benign Het
Traf3 T A 12: 111,243,478 C169* probably null Het
Ucp3 G T 7: 100,485,043 V288L probably benign Het
Ulk3 C A 9: 57,590,356 C4* probably null Het
Vmn1r73 A T 7: 11,757,070 T272S probably benign Het
Vmn2r3 T A 3: 64,275,366 N304I probably damaging Het
Xylt1 G T 7: 117,634,701 G485V probably damaging Het
Yars A G 4: 129,197,188 T130A probably benign Het
Zfp652 A T 11: 95,753,469 R205* probably null Het
Other mutations in Vmn2r115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r115 APN 17 23346206 missense possibly damaging 0.90
IGL00990:Vmn2r115 APN 17 23346176 missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23359349 missense probably benign 0.22
IGL00990:Vmn2r115 APN 17 23346339 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23346278 missense probably benign 0.14
IGL00990:Vmn2r115 APN 17 23346161 missense probably benign 0.03
IGL00990:Vmn2r115 APN 17 23359397 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23346371 nonsense probably null
IGL00990:Vmn2r115 APN 17 23346372 missense probably benign 0.30
IGL00990:Vmn2r115 APN 17 23356960 missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23346264 missense probably benign 0.19
IGL00990:Vmn2r115 APN 17 23359779 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23359824 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23348034 nonsense probably null
IGL01073:Vmn2r115 APN 17 23345997 missense probably benign 0.12
IGL01101:Vmn2r115 APN 17 23345997 missense probably benign 0.12
IGL01300:Vmn2r115 APN 17 23359781 missense probably damaging 1.00
IGL01415:Vmn2r115 APN 17 23359781 missense probably damaging 1.00
IGL02309:Vmn2r115 APN 17 23345139 missense probably benign 0.01
IGL02863:Vmn2r115 APN 17 23359283 missense probably damaging 0.97
R0197:Vmn2r115 UTSW 17 23359781 missense probably damaging 1.00
R0361:Vmn2r115 UTSW 17 23345222 missense probably benign 0.11
R0601:Vmn2r115 UTSW 17 23360100 missense probably null 0.51
R0676:Vmn2r115 UTSW 17 23346264 missense probably benign 0.19
R0685:Vmn2r115 UTSW 17 23359275 missense probably benign
R0865:Vmn2r115 UTSW 17 23346408 missense possibly damaging 0.65
R1124:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1145:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1146:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1207:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1266:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1318:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1367:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1376:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1376:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1420:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1469:Vmn2r115 UTSW 17 23346018 missense probably damaging 0.99
R1469:Vmn2r115 UTSW 17 23346018 missense probably damaging 0.99
R1604:Vmn2r115 UTSW 17 23345271 missense probably benign 0.12
R1645:Vmn2r115 UTSW 17 23346218 missense possibly damaging 0.69
R1646:Vmn2r115 UTSW 17 23359539 missense probably damaging 1.00
R1650:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1678:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1716:Vmn2r115 UTSW 17 23347821 missense probably benign
R1846:Vmn2r115 UTSW 17 23359383 missense probably damaging 1.00
R1847:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1885:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1887:Vmn2r115 UTSW 17 23346033 missense possibly damaging 0.91
R1937:Vmn2r115 UTSW 17 23359414 missense probably damaging 1.00
R2007:Vmn2r115 UTSW 17 23347953 missense possibly damaging 0.94
R2120:Vmn2r115 UTSW 17 23359323 missense probably damaging 1.00
R3161:Vmn2r115 UTSW 17 23357024 missense possibly damaging 0.82
R3780:Vmn2r115 UTSW 17 23345172 missense probably damaging 1.00
R3806:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R3982:Vmn2r115 UTSW 17 23359974 missense probably damaging 1.00
R4019:Vmn2r115 UTSW 17 23360043 missense probably damaging 1.00
R4039:Vmn2r115 UTSW 17 23345103 missense probably benign 0.26
R4087:Vmn2r115 UTSW 17 23346384 missense probably benign 0.35
R4089:Vmn2r115 UTSW 17 23346384 missense probably benign 0.35
R4379:Vmn2r115 UTSW 17 23345223 missense possibly damaging 0.95
R4417:Vmn2r115 UTSW 17 23345880 missense probably benign 0.02
R4601:Vmn2r115 UTSW 17 23346399 missense probably benign 0.01
R4874:Vmn2r115 UTSW 17 23359851 missense probably damaging 1.00
R5466:Vmn2r115 UTSW 17 23360056 missense probably damaging 1.00
R5613:Vmn2r115 UTSW 17 23345333 missense probably benign
R5821:Vmn2r115 UTSW 17 23347963 missense probably damaging 0.99
R6120:Vmn2r115 UTSW 17 23346029 missense probably damaging 1.00
R6193:Vmn2r115 UTSW 17 23357009 missense probably benign 0.01
R6213:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R6290:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R6319:Vmn2r115 UTSW 17 23347903 missense possibly damaging 0.70
R6495:Vmn2r115 UTSW 17 23359598 missense probably benign 0.02
R6599:Vmn2r115 UTSW 17 23346032 missense probably benign 0.00
R6764:Vmn2r115 UTSW 17 23346072 missense probably damaging 1.00
R6970:Vmn2r115 UTSW 17 23346015 missense probably benign 0.23
R7023:Vmn2r115 UTSW 17 23359811 missense probably damaging 1.00
R7236:Vmn2r115 UTSW 17 23359602 missense probably benign 0.01
V5622:Vmn2r115 UTSW 17 23346227 missense probably damaging 1.00
V5622:Vmn2r115 UTSW 17 23359359 missense probably benign
X0023:Vmn2r115 UTSW 17 23359988 small deletion probably benign
X0033:Vmn2r115 UTSW 17 23359988 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ATGGGACTTTTGCTTTTGGACAACAC -3'
(R):5'- AGGTCTACATGGACAGATTCTGCCTC -3'

Sequencing Primer
(F):5'- GCTTTTGGACAACACCATAGTGAG -3'
(R):5'- CAGATTCTGCCTCATAGTATATTCG -3'
Posted On2014-05-07