Incidental Mutation 'R0023:Btbd9'
ID178063
Institutional Source Beutler Lab
Gene Symbol Btbd9
Ensembl Gene ENSMUSG00000062202
Gene NameBTB (POZ) domain containing 9
Synonyms1700023F20Rik
MMRRC Submission 038318-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0023 (G1)
Quality Score48
Status Validated
Chromosome17
Chromosomal Location30215524-30576287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30530214 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 42 (V42E)
Ref Sequence ENSEMBL: ENSMUSP00000127300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079924] [ENSMUST00000168787]
Predicted Effect probably damaging
Transcript: ENSMUST00000079924
AA Change: V42E

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078845
Gene: ENSMUSG00000062202
AA Change: V42E

DomainStartEndE-ValueType
BTB 36 137 3.52e-25 SMART
BACK 143 240 1.84e-18 SMART
Pfam:F5_F8_type_C 283 405 3.9e-11 PFAM
Pfam:F5_F8_type_C 431 554 6.3e-12 PFAM
low complexity region 585 612 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168787
AA Change: V42E

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127300
Gene: ENSMUSG00000062202
AA Change: V42E

DomainStartEndE-ValueType
BTB 36 137 3.52e-25 SMART
BACK 143 240 1.84e-18 SMART
Pfam:F5_F8_type_C 278 405 1.1e-8 PFAM
Pfam:F5_F8_type_C 433 554 1.4e-8 PFAM
low complexity region 585 612 N/A INTRINSIC
Meta Mutation Damage Score 0.43 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a BTB/POZ domain-containing protein. This domain is known to be involved in protein-protein interactions. Polymorphisms at this locus have been reported to be associated with susceptibility to Restless Legs Syndrome and may also be associated with Tourette Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele show hyperactivity, unidirectional circling, sleep disturbances, thermal sensory alterations, increased serum iron levels, altered serotonin metabolism, enhanced long-term potentiation and paired-pulse ratios, and enhanced cued and contextual fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik A C 4: 144,528,997 D329A probably damaging Het
Abcc12 T A 8: 86,538,333 H661L probably damaging Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Acsbg2 C G 17: 56,847,710 A481P probably damaging Het
Aknad1 T A 3: 108,781,185 C610S probably benign Het
Ang4 G T 14: 51,764,403 Y29* probably null Het
Aqp11 A T 7: 97,726,689 I251N possibly damaging Het
Arid1a G T 4: 133,691,176 T1032K unknown Het
Atg16l1 T C 1: 87,789,465 V538A probably benign Het
Bbs1 C T 19: 4,906,014 A44T probably damaging Het
Bpifa3 A C 2: 154,138,150 H234P probably damaging Het
Carmil3 C G 14: 55,492,876 S15R probably damaging Het
Casp8ap2 A G 4: 32,640,185 D413G probably damaging Het
Cfap44 T A 16: 44,421,220 F651L probably benign Het
Clcn3 A T 8: 60,933,070 probably benign Het
Crip3 A G 17: 46,430,994 K136E probably damaging Het
Ctr9 G A 7: 111,043,947 A509T possibly damaging Het
D930020B18Rik T C 10: 121,689,821 S367P probably damaging Het
Dhrs11 A T 11: 84,823,150 L125H probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Efcab7 A T 4: 99,901,637 probably benign Het
Eif2ak4 A C 2: 118,462,721 S1253R probably damaging Het
Emc1 A G 4: 139,371,009 D767G probably damaging Het
Fads1 G A 19: 10,186,897 probably benign Het
Fbxw26 T C 9: 109,718,011 T449A probably benign Het
Frrs1 T C 3: 116,896,788 F27L probably damaging Het
Fry T C 5: 150,451,098 S2358P possibly damaging Het
Gas6 A C 8: 13,470,344 L448R probably damaging Het
Hikeshi T C 7: 89,920,204 probably benign Het
Ifngr1 C T 10: 19,609,449 R399* probably null Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Knl1 C T 2: 119,102,549 T2063I possibly damaging Het
Lyzl6 A G 11: 103,636,871 V9A probably benign Het
Macf1 A T 4: 123,488,314 probably benign Het
Myo6 T C 9: 80,283,534 V789A possibly damaging Het
Myo9b A T 8: 71,333,768 R693W probably damaging Het
Nasp A G 4: 116,605,771 probably benign Het
Nr1i3 T C 1: 171,217,331 F247L probably damaging Het
Plekhs1 T G 19: 56,478,516 S260A probably damaging Het
Rpl21-ps6 T C 17: 55,915,536 noncoding transcript Het
Rtcb A T 10: 85,949,451 probably benign Het
Sppl2a T A 2: 126,913,293 probably null Het
Suco A T 1: 161,845,585 probably null Het
Tnn T A 1: 160,104,928 T1075S probably benign Het
Traf3 T A 12: 111,243,478 C169* probably null Het
Ucp3 G T 7: 100,485,043 V288L probably benign Het
Ulk3 C A 9: 57,590,356 C4* probably null Het
Vmn1r73 A T 7: 11,757,070 T272S probably benign Het
Vmn2r115 G A 17: 23,346,278 E380K probably benign Het
Vmn2r3 T A 3: 64,275,366 N304I probably damaging Het
Xylt1 G T 7: 117,634,701 G485V probably damaging Het
Yars A G 4: 129,197,188 T130A probably benign Het
Zfp652 A T 11: 95,753,469 R205* probably null Het
Other mutations in Btbd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01519:Btbd9 APN 17 30299601 missense possibly damaging 0.71
IGL01651:Btbd9 APN 17 30220417 missense unknown
IGL01814:Btbd9 APN 17 30299535 missense probably benign 0.01
IGL01820:Btbd9 APN 17 30527409 missense possibly damaging 0.82
IGL02014:Btbd9 APN 17 30517150 missense probably damaging 0.98
IGL02075:Btbd9 APN 17 30274936 nonsense probably null
IGL02390:Btbd9 APN 17 30524814 missense probably benign 0.22
IGL02414:Btbd9 APN 17 30220559 missense possibly damaging 0.95
IGL02748:Btbd9 APN 17 30334297 missense possibly damaging 0.81
crumbs UTSW 17 30299736 intron probably null
grain UTSW 17 30274942 missense possibly damaging 0.92
R0023:Btbd9 UTSW 17 30530214 missense probably damaging 0.96
R0122:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0123:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0134:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0189:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0190:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0226:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0268:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0344:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0427:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0462:Btbd9 UTSW 17 30530217 missense possibly damaging 0.82
R0645:Btbd9 UTSW 17 30524967 missense probably damaging 0.96
R0973:Btbd9 UTSW 17 30299633 missense probably damaging 0.99
R0973:Btbd9 UTSW 17 30299633 missense probably damaging 0.99
R0974:Btbd9 UTSW 17 30299633 missense probably damaging 0.99
R1061:Btbd9 UTSW 17 30527435 missense probably benign 0.00
R1763:Btbd9 UTSW 17 30334297 missense possibly damaging 0.81
R1781:Btbd9 UTSW 17 30513593 missense probably damaging 1.00
R1902:Btbd9 UTSW 17 30530228 missense probably damaging 0.98
R1995:Btbd9 UTSW 17 30274930 missense possibly damaging 0.93
R2224:Btbd9 UTSW 17 30527346 missense probably damaging 0.98
R2237:Btbd9 UTSW 17 30334328 missense probably benign
R3684:Btbd9 UTSW 17 30334307 missense probably damaging 0.99
R3800:Btbd9 UTSW 17 30513659 missense possibly damaging 0.89
R4403:Btbd9 UTSW 17 30485932 intron probably benign
R4492:Btbd9 UTSW 17 30527571 missense probably damaging 0.99
R4654:Btbd9 UTSW 17 30485587 intron probably benign
R4854:Btbd9 UTSW 17 30524865 missense probably damaging 0.98
R5710:Btbd9 UTSW 17 30228868 missense probably benign 0.16
R5963:Btbd9 UTSW 17 30334218 splice site probably null
R6295:Btbd9 UTSW 17 30299736 intron probably null
R6422:Btbd9 UTSW 17 30530256 missense probably benign
R7023:Btbd9 UTSW 17 30527572 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGTCCTTCAGACATCACGCACAAAG -3'
(R):5'- GGCCAGTGACTATCATCTGTTCCAC -3'

Sequencing Primer
(F):5'- AGACACTGGATTCCACTTGG -3'
(R):5'- TCATCTGTTCCACAGGATGAG -3'
Posted On2014-05-07