Incidental Mutation 'R0423:Sptan1'
ID186127
Institutional Source Beutler Lab
Gene Symbol Sptan1
Ensembl Gene ENSMUSG00000057738
Gene Namespectrin alpha, non-erythrocytic 1
Synonymsalpha-fodrin, Spna2, 2610027H02Rik, Spna-2
MMRRC Submission 038625-MU
Accession Numbers

Ncbi RefSeq: NM_001076554.2, NM_001177667.1, NM_001177668.1; MGI:98386

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0423 (G1)
Quality Score56
Status Validated
Chromosome2
Chromosomal Location29965560-30031451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 30028672 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 2246 (C2246G)
Ref Sequence ENSEMBL: ENSMUSP00000121116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046257] [ENSMUST00000095083] [ENSMUST00000100225] [ENSMUST00000113711] [ENSMUST00000113717] [ENSMUST00000113719] [ENSMUST00000129241]
Predicted Effect probably benign
Transcript: ENSMUST00000046257
SMART Domains Protein: ENSMUSP00000047792
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1635 9.65e-30 SMART
SPEC 1641 1741 2.32e-32 SMART
SPEC 1747 1847 6.98e-36 SMART
SPEC 1853 1953 1.53e-32 SMART
SPEC 1959 2060 6.23e-24 SMART
SPEC 2074 2174 2.08e-11 SMART
SPEC 2188 2289 1.07e-4 SMART
EFh 2307 2335 5.78e-7 SMART
EFh 2350 2378 3.85e-3 SMART
efhand_Ca_insen 2382 2451 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095083
SMART Domains Protein: ENSMUSP00000092697
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1655 9.65e-30 SMART
SPEC 1661 1761 2.32e-32 SMART
SPEC 1767 1867 6.98e-36 SMART
SPEC 1873 1973 1.53e-32 SMART
SPEC 1979 2080 6.23e-24 SMART
SPEC 2094 2194 2.08e-11 SMART
SPEC 2208 2309 1.07e-4 SMART
EFh 2327 2355 5.78e-7 SMART
EFh 2370 2398 3.85e-3 SMART
efhand_Ca_insen 2402 2471 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100225
SMART Domains Protein: ENSMUSP00000097797
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1660 2.06e-24 SMART
SPEC 1666 1766 2.32e-32 SMART
SPEC 1772 1872 6.98e-36 SMART
SPEC 1878 1978 1.53e-32 SMART
SPEC 1984 2085 6.23e-24 SMART
SPEC 2099 2199 2.08e-11 SMART
SPEC 2213 2314 1.07e-4 SMART
EFh 2332 2360 5.78e-7 SMART
EFh 2375 2403 3.85e-3 SMART
efhand_Ca_insen 2407 2476 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113711
SMART Domains Protein: ENSMUSP00000109340
Gene: ENSMUSG00000039715

DomainStartEndE-ValueType
low complexity region 11 36 N/A INTRINSIC
low complexity region 90 100 N/A INTRINSIC
Blast:WD40 146 200 3e-28 BLAST
WD40 207 247 2e-1 SMART
WD40 256 300 3.42e1 SMART
Blast:WD40 323 364 8e-10 BLAST
WD40 382 422 1.66e-5 SMART
WD40 425 465 3.09e-1 SMART
WD40 470 512 4.18e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113717
SMART Domains Protein: ENSMUSP00000109346
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2294 1.07e-4 SMART
EFh 2312 2340 5.78e-7 SMART
EFh 2355 2383 3.85e-3 SMART
efhand_Ca_insen 2387 2456 6.74e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113719
AA Change: C2226G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109348
Gene: ENSMUSG00000057738
AA Change: C2226G

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2315 3.27e0 SMART
EFh 2333 2361 5.78e-7 SMART
EFh 2376 2404 3.85e-3 SMART
efhand_Ca_insen 2408 2477 6.74e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124494
Predicted Effect probably null
Transcript: ENSMUST00000129241
AA Change: C2246G
SMART Domains Protein: ENSMUSP00000121116
Gene: ENSMUSG00000057738
AA Change: C2246G

DomainStartEndE-ValueType
Pfam:Spectrin 1 65 9.9e-10 PFAM
SPEC 78 178 2.08e-11 SMART
SPEC 192 314 3.27e0 SMART
EFh 332 360 5.78e-7 SMART
EFh 375 403 3.85e-3 SMART
efhand_Ca_insen 407 476 6.74e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201758
Meta Mutation Damage Score 0.616 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 99% (84/85)
MGI Phenotype Strain: 3714925; 4330132
Lethality: E12-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are a family of filamentous cytoskeletal proteins that function as essential scaffold proteins that stabilize the plasma membrane and organize intracellular organelles. Spectrins are composed of alpha and beta dimers that associate to form tetramers linked in a head-to-head arrangement. This gene encodes an alpha spectrin that is specifically expressed in nonerythrocytic cells. The encoded protein has been implicated in other cellular functions including DNA repair and cell cycle regulation. Mutations in this gene are the cause of early infantile epileptic encephalopathy-5. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous deletion of the exons encoding the CCC region are normal. Mice homozygous for a gene trap allele exhibit embryonic lethality and abnormal nervous system, heart and craniofacial morphology. [provided by MGI curators]
Allele List at MGI

All alleles(76) : Targeted(1) Gene trapped(75)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik T C 2: 28,466,024 probably benign Het
4930432E11Rik A T 7: 29,562,400 noncoding transcript Het
A630001G21Rik A G 1: 85,726,466 I50T probably benign Het
Abhd12 T C 2: 150,838,392 T264A possibly damaging Het
Acsm3 T C 7: 119,777,159 Y370H probably damaging Het
Ank2 G T 3: 126,929,860 Y3789* probably null Het
Anxa4 C T 6: 86,760,737 A1T probably damaging Het
Apba1 T A 19: 23,944,998 V810D probably damaging Het
Bank1 A G 3: 136,284,017 I104T possibly damaging Het
Birc6 T C 17: 74,696,297 Y4721H probably damaging Het
Bmpr2 A G 1: 59,868,510 T921A probably benign Het
Ccdc102a A C 8: 94,905,926 probably benign Het
Ccdc141 C A 2: 77,039,450 D904Y probably damaging Het
Ccdc96 A G 5: 36,485,247 K199R probably benign Het
Cdh10 G A 15: 18,986,879 V399I probably benign Het
Cenpk A G 13: 104,234,225 T85A probably benign Het
Col6a2 A C 10: 76,614,917 V60G possibly damaging Het
Cops7b A G 1: 86,599,031 D119G probably benign Het
Cstf2t A G 19: 31,084,276 E404G possibly damaging Het
Ctnna2 A T 6: 77,653,069 V134E probably damaging Het
Cwh43 A C 5: 73,416,742 M250L probably benign Het
D17Wsu92e A C 17: 27,786,233 Y117D probably damaging Het
Daam2 T A 17: 49,469,421 K813* probably null Het
Dhcr24 G A 4: 106,586,536 probably benign Het
Dnah8 G T 17: 30,701,981 R1182L probably benign Het
Doc2a C T 7: 126,848,658 P25S probably damaging Het
Dst A G 1: 34,278,035 S6823G possibly damaging Het
Espl1 T A 15: 102,303,986 L509* probably null Het
Fbxw19 C T 9: 109,486,066 V143I probably benign Het
Fbxw5 A G 2: 25,504,526 T171A possibly damaging Het
Gfra2 C T 14: 70,896,081 T117M probably damaging Het
Gm454 T A 5: 138,204,141 noncoding transcript Het
Kcnq4 A G 4: 120,717,508 S120P probably damaging Het
Krt84 A T 15: 101,528,720 L336Q probably damaging Het
Lilra6 T A 7: 3,914,775 probably benign Het
Mbnl2 G A 14: 120,325,324 R29H probably damaging Het
Mcm3ap G A 10: 76,502,705 G1389D probably benign Het
Mettl13 A T 1: 162,544,385 I305N probably damaging Het
Muc6 A G 7: 141,652,283 S30P probably benign Het
Myh7 T A 14: 54,979,189 Q1237L probably benign Het
Myo9a T G 9: 59,895,336 D2035E probably damaging Het
Nat10 A G 2: 103,748,227 S211P probably damaging Het
Ntm T C 9: 29,179,099 Y108C probably damaging Het
Olfr292 T C 7: 86,695,226 Y257H possibly damaging Het
Olfr843 A T 9: 19,248,952 L149* probably null Het
Pcdhb16 A G 18: 37,480,369 D794G probably benign Het
Phlpp1 A G 1: 106,339,615 T753A probably benign Het
Pnldc1 T C 17: 12,890,076 Q511R possibly damaging Het
Ppip5k2 A G 1: 97,761,427 S38P possibly damaging Het
Pygb A G 2: 150,823,984 K593E probably benign Het
Rangap1 A T 15: 81,705,463 F564I probably damaging Het
Rictor A T 15: 6,773,900 I498F possibly damaging Het
Rnase12 A T 14: 51,057,156 V22D probably benign Het
Rpl7l1 T A 17: 46,780,398 M93L probably benign Het
Smg1 T C 7: 118,176,880 R1396G possibly damaging Het
Snx19 C A 9: 30,435,837 T692N probably damaging Het
Spag6 A G 2: 18,710,593 D61G probably benign Het
Spen T A 4: 141,479,336 N660I unknown Het
Svopl A G 6: 38,036,707 probably benign Het
Taf2 A T 15: 55,064,682 N108K probably benign Het
Thbs4 T C 13: 92,756,571 D703G probably damaging Het
Tle6 G T 10: 81,598,623 N47K possibly damaging Het
Usp48 G T 4: 137,616,411 V452L probably benign Het
Ust A T 10: 8,298,148 S198T probably damaging Het
Wnk2 T A 13: 49,095,418 M386L possibly damaging Het
Ywhaq T C 12: 21,391,381 probably benign Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp316 A G 5: 143,253,238 S1009P probably damaging Het
Zfp963 A G 8: 69,744,506 Y29H probably damaging Het
Zmym4 A G 4: 126,882,319 probably benign Het
Zranb3 A G 1: 128,091,870 I45T probably damaging Het
Other mutations in Sptan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Sptan1 APN 2 29993956 critical splice donor site probably null
IGL00932:Sptan1 APN 2 30015610 missense probably damaging 1.00
IGL00945:Sptan1 APN 2 30000071 splice site probably benign
IGL01070:Sptan1 APN 2 30014173 critical splice donor site probably null
IGL01625:Sptan1 APN 2 30026114 missense probably damaging 1.00
IGL01657:Sptan1 APN 2 30018479 missense probably benign 0.12
IGL01795:Sptan1 APN 2 30018489 missense probably benign 0.07
IGL01982:Sptan1 APN 2 30019968 missense probably damaging 1.00
IGL02040:Sptan1 APN 2 30013713 missense probably benign 0.43
IGL02158:Sptan1 APN 2 30030324 missense probably damaging 0.97
IGL02370:Sptan1 APN 2 30030740 missense probably damaging 0.99
IGL02507:Sptan1 APN 2 30016055 missense probably damaging 1.00
IGL02552:Sptan1 APN 2 30018474 missense probably damaging 0.99
IGL02690:Sptan1 APN 2 29998183 missense possibly damaging 0.78
IGL02715:Sptan1 APN 2 29978576 missense probably benign 0.03
IGL02725:Sptan1 APN 2 29996043 missense probably damaging 0.99
IGL03033:Sptan1 APN 2 29991033 missense probably damaging 1.00
IGL03304:Sptan1 APN 2 29986493 missense probably damaging 1.00
IGL03405:Sptan1 APN 2 30025581 missense probably damaging 0.99
R0058:Sptan1 UTSW 2 29993696 splice site probably null
R0058:Sptan1 UTSW 2 29993696 splice site probably null
R0066:Sptan1 UTSW 2 30003667 splice site probably benign
R0066:Sptan1 UTSW 2 30003667 splice site probably benign
R0071:Sptan1 UTSW 2 30003342 nonsense probably null
R0071:Sptan1 UTSW 2 30003342 nonsense probably null
R0094:Sptan1 UTSW 2 30006623 missense probably benign 0.37
R0230:Sptan1 UTSW 2 30010692 splice site probably benign
R0242:Sptan1 UTSW 2 30018401 missense probably benign 0.00
R0242:Sptan1 UTSW 2 30018401 missense probably benign 0.00
R0366:Sptan1 UTSW 2 29992752 splice site probably null
R0368:Sptan1 UTSW 2 29993915 missense probably benign 0.29
R0396:Sptan1 UTSW 2 29991033 missense probably damaging 1.00
R0448:Sptan1 UTSW 2 30026810 missense probably damaging 1.00
R0485:Sptan1 UTSW 2 30013848 splice site probably benign
R0580:Sptan1 UTSW 2 30007575 missense probably damaging 0.99
R0739:Sptan1 UTSW 2 30013518 missense probably damaging 1.00
R0924:Sptan1 UTSW 2 30016028 missense probably damaging 0.98
R0930:Sptan1 UTSW 2 30016028 missense probably damaging 0.98
R0961:Sptan1 UTSW 2 29980063 splice site probably null
R1352:Sptan1 UTSW 2 30021187 splice site probably benign
R1456:Sptan1 UTSW 2 29980203 critical splice donor site probably null
R1537:Sptan1 UTSW 2 30026022 missense possibly damaging 0.95
R1542:Sptan1 UTSW 2 30027127 missense probably damaging 1.00
R1612:Sptan1 UTSW 2 30003336 missense probably damaging 1.00
R1623:Sptan1 UTSW 2 29986420 missense probably damaging 0.96
R1834:Sptan1 UTSW 2 29992001 splice site probably benign
R1879:Sptan1 UTSW 2 29995528 missense probably damaging 1.00
R1893:Sptan1 UTSW 2 30020460 missense probably damaging 0.98
R1914:Sptan1 UTSW 2 30011036 missense probably benign 0.00
R1915:Sptan1 UTSW 2 30011036 missense probably benign 0.00
R2022:Sptan1 UTSW 2 30007561 missense probably damaging 0.96
R2050:Sptan1 UTSW 2 30002238 missense probably benign
R2103:Sptan1 UTSW 2 30030471 missense probably damaging 1.00
R2162:Sptan1 UTSW 2 30018576 splice site probably benign
R2931:Sptan1 UTSW 2 30018488 missense probably benign
R3726:Sptan1 UTSW 2 30018419 missense possibly damaging 0.59
R4170:Sptan1 UTSW 2 30030025 missense possibly damaging 0.93
R4235:Sptan1 UTSW 2 30026588 missense probably damaging 1.00
R4378:Sptan1 UTSW 2 30025569 missense probably damaging 1.00
R4424:Sptan1 UTSW 2 30029709 intron probably benign
R4718:Sptan1 UTSW 2 30031062 missense probably damaging 1.00
R4777:Sptan1 UTSW 2 29996435 missense probably damaging 0.98
R4849:Sptan1 UTSW 2 30011042 missense probably damaging 1.00
R5158:Sptan1 UTSW 2 29978443 missense probably damaging 1.00
R5180:Sptan1 UTSW 2 29993724 intron probably benign
R5181:Sptan1 UTSW 2 29993724 intron probably benign
R5383:Sptan1 UTSW 2 30011328 missense probably damaging 1.00
R5573:Sptan1 UTSW 2 29986492 nonsense probably null
R5592:Sptan1 UTSW 2 29986719 intron probably benign
R5639:Sptan1 UTSW 2 29990993 nonsense probably null
R5801:Sptan1 UTSW 2 30030601 splice site probably null
R5947:Sptan1 UTSW 2 29994367 critical splice donor site probably null
R6056:Sptan1 UTSW 2 29996782 missense probably benign 0.36
R6090:Sptan1 UTSW 2 29993887 missense probably damaging 1.00
R6146:Sptan1 UTSW 2 30004523 missense probably benign 0.01
R6254:Sptan1 UTSW 2 30007549 missense possibly damaging 0.93
R6366:Sptan1 UTSW 2 30020455 missense possibly damaging 0.47
R6378:Sptan1 UTSW 2 30018515 missense probably damaging 1.00
R6521:Sptan1 UTSW 2 30020455 missense possibly damaging 0.47
R6877:Sptan1 UTSW 2 30030973 missense probably damaging 0.99
X0028:Sptan1 UTSW 2 30020030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTAGTGACCACAGAAATCTGCCC -3'
(R):5'- GTAGTTAAGACTCACAGGCACACCC -3'

Sequencing Primer
(F):5'- AACCATTGAGACTGTAGGCTTTG -3'
(R):5'- CGTCCCCCAGGAAAAGG -3'
Posted On2014-05-07