Incidental Mutation 'R0426:Zfp516'
ID186138
Institutional Source Beutler Lab
Gene Symbol Zfp516
Ensembl Gene ENSMUSG00000058881
Gene Namezinc finger protein 516
SynonymsC330029B10Rik, Zfp26l
MMRRC Submission 038628-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R0426 (G1)
Quality Score61
Status Validated
Chromosome18
Chromosomal Location82910879-83005314 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 82955772 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 32 (A32S)
Ref Sequence ENSEMBL: ENSMUSP00000126629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071233] [ENSMUST00000171238]
Predicted Effect probably benign
Transcript: ENSMUST00000071233
AA Change: A32S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000071216
Gene: ENSMUSG00000058881
AA Change: A32S

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
ZnF_C2H2 34 56 1.03e-2 SMART
ZnF_C2H2 62 84 3.95e-4 SMART
ZnF_C2H2 162 185 8.09e-1 SMART
ZnF_C2H2 188 211 1.76e-1 SMART
ZnF_C2H2 236 258 3.16e-3 SMART
ZnF_C2H2 264 286 3.34e-2 SMART
ZnF_C2H2 323 345 2.63e0 SMART
ZnF_C2H2 504 526 5.72e-1 SMART
low complexity region 527 544 N/A INTRINSIC
ZnF_C2H2 753 776 2.97e1 SMART
low complexity region 834 846 N/A INTRINSIC
ZnF_C2H2 1092 1114 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171238
AA Change: A32S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000126629
Gene: ENSMUSG00000058881
AA Change: A32S

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
ZnF_C2H2 34 56 1.03e-2 SMART
ZnF_C2H2 62 84 3.95e-4 SMART
ZnF_C2H2 162 185 8.09e-1 SMART
ZnF_C2H2 188 211 1.76e-1 SMART
ZnF_C2H2 236 258 3.16e-3 SMART
ZnF_C2H2 264 286 3.34e-2 SMART
ZnF_C2H2 323 345 2.63e0 SMART
ZnF_C2H2 504 526 5.72e-1 SMART
low complexity region 527 544 N/A INTRINSIC
ZnF_C2H2 753 776 2.97e1 SMART
low complexity region 834 846 N/A INTRINSIC
ZnF_C2H2 1092 1114 1.12e-3 SMART
Meta Mutation Damage Score 0.1584 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (86/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc-finger proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation, and apoptosis. This gene encodes a zinc-finger protein, and belongs to the krueppel C2H2-type zinc-finger protein family. It may be involved in transcriptional regulation. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik C T 5: 107,510,373 T1603I probably damaging Het
Abca8b G T 11: 109,955,027 probably benign Het
Acadl A T 1: 66,841,646 F320L probably damaging Het
Acsbg1 T C 9: 54,622,746 D222G probably benign Het
Anapc15 A G 7: 101,898,033 T39A probably benign Het
Ano3 A T 2: 110,661,174 V919E probably damaging Het
Arhgef12 T C 9: 42,970,990 probably null Het
Atad5 T A 11: 80,112,832 I1091N probably benign Het
Atf1 A T 15: 100,232,827 H26L possibly damaging Het
Atp10a T C 7: 58,784,734 M252T probably benign Het
Cd55 C T 1: 130,448,372 R347H probably benign Het
Cdc27 A C 11: 104,513,027 probably null Het
Cdh9 G A 15: 16,823,454 probably null Het
Cdk11b T C 4: 155,642,512 probably benign Het
Cep70 A G 9: 99,297,684 D567G probably benign Het
Cep78 A T 19: 15,970,970 Y382* probably null Het
Col9a2 T C 4: 121,044,660 probably benign Het
Cyp2d12 G A 15: 82,558,963 D409N probably benign Het
Ddx39 A G 8: 83,721,769 T217A probably benign Het
Dennd1b T A 1: 139,170,196 D733E probably benign Het
Dicer1 A G 12: 104,702,542 S1294P probably damaging Het
Dnah3 T C 7: 119,943,572 E3539G probably benign Het
Dnmbp A G 19: 43,852,436 probably benign Het
Dysf T C 6: 84,149,757 L1332P probably damaging Het
F5 A G 1: 164,182,840 D380G probably damaging Het
Fam160a2 A C 7: 105,389,473 C186W probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Galr2 C A 11: 116,281,691 A69D probably damaging Het
Grk2 T C 19: 4,290,600 probably null Het
Gtf3c1 A T 7: 125,663,016 Y1119* probably null Het
Hgd A T 16: 37,588,685 probably benign Het
Ildr2 G T 1: 166,308,899 V436L probably benign Het
Intu G A 3: 40,675,305 C355Y probably damaging Het
Irf2bpl G T 12: 86,883,096 P268T probably benign Het
Jarid2 T C 13: 44,840,882 probably null Het
Jup A T 11: 100,372,401 M716K probably benign Het
Kank1 G A 19: 25,411,473 V809I probably damaging Het
Kdm1b T A 13: 47,064,244 probably benign Het
Kdm3a C T 6: 71,600,755 C687Y probably damaging Het
Kdm5d T A Y: 942,437 probably benign Het
Kifap3 T A 1: 163,865,552 probably benign Het
Macf1 T A 4: 123,483,660 K1400* probably null Het
Majin A G 19: 6,212,117 probably benign Het
Mb21d1 G A 9: 78,435,738 probably benign Het
Mctp1 A G 13: 77,020,821 I846V probably benign Het
Mrgpra2b T A 7: 47,464,127 I286F possibly damaging Het
Neil3 T G 8: 53,609,396 probably benign Het
Nox3 G T 17: 3,695,563 N23K probably damaging Het
Nt5c3 T C 6: 56,883,812 K219E probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr213 A T 6: 116,540,485 N11Y probably damaging Het
Olfr389 T A 11: 73,776,437 M297L probably benign Het
Olfr524 A C 7: 140,202,116 F218C possibly damaging Het
Olfr548-ps1 T A 7: 102,542,686 I250N probably damaging Het
Olfr954 T C 9: 39,461,593 L54P probably damaging Het
Pacsin2 A G 15: 83,379,795 V347A possibly damaging Het
Pcdhb7 A T 18: 37,342,804 E331V probably damaging Het
Pcid2 A C 8: 13,081,262 probably null Het
Pcsk9 T C 4: 106,450,077 D323G possibly damaging Het
Pdhb T C 14: 8,169,801 E203G probably damaging Het
Phlpp2 A G 8: 109,928,463 Y630C probably benign Het
Pidd1 C T 7: 141,439,133 A812T probably damaging Het
Plau G A 14: 20,842,314 R389H probably benign Het
Plekhg6 G A 6: 125,364,629 probably null Het
Ppox T C 1: 171,277,749 Y321C probably damaging Het
Pxdn A G 12: 29,987,066 N281S possibly damaging Het
Pycrl A T 15: 75,918,388 M138K probably benign Het
Radil T C 5: 142,497,873 Y526C probably damaging Het
Ranbp3 C A 17: 56,707,169 D233E probably benign Het
Rhpn1 A G 15: 75,711,872 Q402R possibly damaging Het
Sec23b T A 2: 144,568,612 probably benign Het
Sel1l2 A T 2: 140,240,912 L602* probably null Het
Sema5b G A 16: 35,646,355 G209D probably damaging Het
Svep1 T C 4: 58,073,333 Y1992C possibly damaging Het
Syncrip T A 9: 88,456,259 probably benign Het
Synj1 G T 16: 90,967,354 A65E probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tecrl T C 5: 83,354,763 probably benign Het
Tenm4 G T 7: 96,777,851 G698C probably damaging Het
Tmem209 G A 6: 30,491,182 L259F probably damaging Het
Tmem247 G A 17: 86,918,503 E124K possibly damaging Het
Tnks2 C A 19: 36,852,821 A218E probably damaging Het
Tppp T A 13: 74,021,311 F57I probably damaging Het
Trim36 A G 18: 46,172,525 W452R probably damaging Het
Vars2 A T 17: 35,664,584 V262E probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Zfy2 G T Y: 2,107,348 L429I possibly damaging Het
Other mutations in Zfp516
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Zfp516 APN 18 82957108 missense probably benign 0.08
IGL01343:Zfp516 APN 18 82993096 missense probably damaging 0.99
IGL01413:Zfp516 APN 18 82987670 nonsense probably null
IGL01684:Zfp516 APN 18 82957201 missense probably damaging 1.00
IGL01820:Zfp516 APN 18 82987361 missense probably benign 0.00
IGL02081:Zfp516 APN 18 82955733 missense probably benign 0.00
IGL02209:Zfp516 APN 18 82994497 missense probably benign
IGL02253:Zfp516 APN 18 82994497 missense probably benign
IGL03028:Zfp516 APN 18 82955913 missense possibly damaging 0.95
IGL03241:Zfp516 APN 18 82987520 missense probably benign 0.01
R0379:Zfp516 UTSW 18 82987670 nonsense probably null
R0466:Zfp516 UTSW 18 82957454 splice site probably null
R0715:Zfp516 UTSW 18 82987263 missense probably damaging 1.00
R1574:Zfp516 UTSW 18 82993175 missense possibly damaging 0.93
R1574:Zfp516 UTSW 18 82993175 missense possibly damaging 0.93
R2110:Zfp516 UTSW 18 82957411 missense probably damaging 0.99
R2112:Zfp516 UTSW 18 82957411 missense probably damaging 0.99
R2162:Zfp516 UTSW 18 82986938 missense possibly damaging 0.95
R2223:Zfp516 UTSW 18 82955770 missense possibly damaging 0.94
R4097:Zfp516 UTSW 18 82987256 missense possibly damaging 0.95
R4299:Zfp516 UTSW 18 82987497 missense possibly damaging 0.80
R4378:Zfp516 UTSW 18 82987180 missense probably benign 0.00
R4601:Zfp516 UTSW 18 82956039 missense probably benign 0.14
R4721:Zfp516 UTSW 18 82957111 missense possibly damaging 0.49
R4946:Zfp516 UTSW 18 82956094 missense probably benign 0.06
R5186:Zfp516 UTSW 18 82957093 missense probably benign
R5351:Zfp516 UTSW 18 82956751 missense probably benign 0.00
R5937:Zfp516 UTSW 18 82956833 missense probably damaging 0.99
R5998:Zfp516 UTSW 18 82956514 missense probably damaging 1.00
R6458:Zfp516 UTSW 18 82987350 missense probably benign 0.03
R6513:Zfp516 UTSW 18 82955710 missense probably damaging 1.00
R6626:Zfp516 UTSW 18 82988107 missense probably damaging 1.00
R6712:Zfp516 UTSW 18 82957308 missense probably damaging 1.00
R6877:Zfp516 UTSW 18 82955791 missense probably damaging 1.00
R6886:Zfp516 UTSW 18 82957000 missense probably benign 0.06
X0019:Zfp516 UTSW 18 82987488 missense probably damaging 1.00
X0065:Zfp516 UTSW 18 82987169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGAGATAAGACACTTCAGGCCC -3'
(R):5'- AGAATCTTGCTGCCGTCCATCG -3'

Sequencing Primer
(F):5'- GACACTTCAGGCCCCTACG -3'
(R):5'- TCTTAGTAGGGCTGGCACAC -3'
Posted On2014-05-07