Incidental Mutation 'R1571:Thbs1'
ID186189
Institutional Source Beutler Lab
Gene Symbol Thbs1
Ensembl Gene ENSMUSG00000040152
Gene Namethrombospondin 1
SynonymsTSP-1, TSP1, tbsp1, Thbs-1
MMRRC Submission 039610-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R1571 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location118111876-118127133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 118119197 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 589 (D589E)
Ref Sequence ENSEMBL: ENSMUSP00000044903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039559]
Predicted Effect probably damaging
Transcript: ENSMUST00000039559
AA Change: D589E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044903
Gene: ENSMUSG00000040152
AA Change: D589E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
TSPN 24 221 2.68e-60 SMART
low complexity region 237 249 N/A INTRINSIC
coiled coil region 292 315 N/A INTRINSIC
VWC 319 373 3.6e-20 SMART
TSP1 383 430 4.21e-12 SMART
TSP1 439 491 3.04e-18 SMART
TSP1 496 548 8.6e-18 SMART
EGF 551 588 3.88e-3 SMART
EGF 592 646 1.69e1 SMART
EGF 650 691 7.13e-2 SMART
Pfam:TSP_3 728 763 5.8e-12 PFAM
Pfam:TSP_3 763 786 2.1e-5 PFAM
Pfam:TSP_3 787 822 3.3e-13 PFAM
Pfam:TSP_3 822 845 1.1e-6 PFAM
Pfam:TSP_3 846 883 2e-15 PFAM
Pfam:TSP_3 884 919 8.3e-13 PFAM
Pfam:TSP_3 920 954 4.9e-10 PFAM
Pfam:TSP_C 973 1170 1.4e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190311
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a subunit of a disulfide-linked homotrimeric protein. This protein is an adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein can bind to fibrinogen, fibronectin, laminin, type V collagen and integrins alpha-V/beta-1. This protein has been shown to play roles in platelet aggregation, angiogenesis, and tumorigenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice show partial prenatal lethality, lordosis, kyphosis, leukocytosis, multiorgan inflammation, lung hemorrhage, pneumonia, resistance to radiation and ischemic injury, altered blood pressure and vasoactive stress responses, eye pathology, and corneal and lacrimal gland dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610524H06Rik A G 5: 114,823,311 probably null Het
Abcd3 T C 3: 121,792,842 I70V possibly damaging Het
Acad10 T C 5: 121,621,348 Y1024C probably damaging Het
Atp2b3 T G X: 73,545,106 V701G probably damaging Het
Cbfa2t2 T A 2: 154,500,427 M21K probably damaging Het
Cdc25a C T 9: 109,881,546 T106I possibly damaging Het
Cdhr5 T C 7: 141,272,170 T190A probably damaging Het
Chl1 A G 6: 103,708,484 T829A probably benign Het
Clcn6 T C 4: 148,012,769 T614A possibly damaging Het
Cntln A T 4: 84,947,586 R160* probably null Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dock3 C A 9: 106,937,959 M1236I possibly damaging Het
Eif4g3 T A 4: 138,120,408 H213Q probably damaging Het
Eya1 T A 1: 14,208,917 H372L probably damaging Het
Fam13b A G 18: 34,497,432 V91A possibly damaging Het
Gm5724 A T 6: 141,754,409 C132* probably null Het
Hat1 T A 2: 71,434,175 I319K probably benign Het
Kcnf1 T C 12: 17,175,852 N123D probably benign Het
Kcns3 C A 12: 11,091,550 G383W probably damaging Het
Kprp A T 3: 92,825,382 C120* probably null Het
Lama3 T A 18: 12,539,717 C2456S probably damaging Het
Lrp1b A T 2: 41,476,646 D539E probably damaging Het
Matn3 T C 12: 8,955,466 L292S probably damaging Het
Mbd3l1 T A 9: 18,484,651 I24N probably damaging Het
Med10 T C 13: 69,810,040 L37P probably damaging Het
Mrc1 A T 2: 14,308,733 H925L probably damaging Het
Myo15 T A 11: 60,518,464 I3219N probably damaging Het
Nom1 C T 5: 29,442,635 Q623* probably null Het
Nrm T A 17: 35,864,187 W136R probably damaging Het
Olfr1098 A C 2: 86,923,445 V29G probably benign Het
Pde7b T C 10: 20,413,090 N298S probably benign Het
Piezo2 C T 18: 63,144,919 A305T possibly damaging Het
Pimreg T C 11: 72,045,216 L175P possibly damaging Het
Pkhd1l1 A G 15: 44,526,841 D1451G probably benign Het
Ptpro A G 6: 137,378,130 S212G probably benign Het
Rhpn1 C T 15: 75,714,118 R627C possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnase4 T G 14: 51,105,040 F74V probably damaging Het
Sbno2 A G 10: 80,060,392 probably null Het
Selp T C 1: 164,126,607 Y159H probably damaging Het
Senp6 A G 9: 80,093,571 T21A probably damaging Het
Slco3a1 T C 7: 74,504,380 D148G possibly damaging Het
Smtn G A 11: 3,530,102 P373L probably benign Het
Snx20 A T 8: 88,629,969 L73Q probably damaging Het
Sobp A G 10: 43,157,946 V128A possibly damaging Het
Tcerg1 A G 18: 42,524,292 T280A unknown Het
Tgfbrap1 A G 1: 43,049,813 V810A probably benign Het
Tjp2 A G 19: 24,100,875 Y885H probably damaging Het
Tmem109 A G 19: 10,872,629 S100P probably damaging Het
Trim36 T C 18: 46,172,495 K462E probably benign Het
Vmn1r226 A T 17: 20,688,276 I257F probably damaging Het
Vmn2r92 A G 17: 18,152,090 Y54C probably damaging Het
Wdcp T A 12: 4,851,924 Y593* probably null Het
Wdr59 T C 8: 111,451,050 S907G probably damaging Het
Other mutations in Thbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Thbs1 APN 2 118122973 missense probably damaging 1.00
IGL00920:Thbs1 APN 2 118113201 missense probably damaging 0.99
IGL01295:Thbs1 APN 2 118118327 missense possibly damaging 0.88
IGL01649:Thbs1 APN 2 118114982 missense probably benign
IGL02077:Thbs1 APN 2 118113110 missense probably benign 0.00
IGL02251:Thbs1 APN 2 118113518 missense probably benign 0.00
IGL02263:Thbs1 APN 2 118119880 missense probably benign 0.06
IGL02392:Thbs1 APN 2 118114660 missense probably benign
IGL02393:Thbs1 APN 2 118123099 missense possibly damaging 0.87
IGL02411:Thbs1 APN 2 118114970 missense probably benign
IGL02659:Thbs1 APN 2 118114792 missense probably benign 0.29
Stark UTSW 2 118121237 critical splice donor site probably null
R0014:Thbs1 UTSW 2 118113350 missense possibly damaging 0.51
R0042:Thbs1 UTSW 2 118122877 missense probably damaging 1.00
R0064:Thbs1 UTSW 2 118123914 critical splice acceptor site probably null
R0240:Thbs1 UTSW 2 118114393 missense probably damaging 1.00
R0240:Thbs1 UTSW 2 118114393 missense probably damaging 1.00
R0316:Thbs1 UTSW 2 118117574 missense probably damaging 1.00
R0393:Thbs1 UTSW 2 118112991 missense possibly damaging 0.69
R0678:Thbs1 UTSW 2 118122906 missense probably damaging 1.00
R1037:Thbs1 UTSW 2 118123051 missense probably damaging 1.00
R1440:Thbs1 UTSW 2 118114355 missense probably damaging 1.00
R1454:Thbs1 UTSW 2 118122672 missense probably damaging 1.00
R1702:Thbs1 UTSW 2 118113442 missense probably benign
R2035:Thbs1 UTSW 2 118118340 critical splice donor site probably null
R2068:Thbs1 UTSW 2 118123537 nonsense probably null
R2171:Thbs1 UTSW 2 118122579 missense probably damaging 1.00
R2844:Thbs1 UTSW 2 118117628 missense probably benign 0.00
R2870:Thbs1 UTSW 2 118119378 missense probably damaging 1.00
R2870:Thbs1 UTSW 2 118119378 missense probably damaging 1.00
R3620:Thbs1 UTSW 2 118121159 missense probably benign 0.05
R3621:Thbs1 UTSW 2 118121159 missense probably benign 0.05
R3726:Thbs1 UTSW 2 118114710 missense probably benign 0.02
R4499:Thbs1 UTSW 2 118119950 missense possibly damaging 0.82
R4524:Thbs1 UTSW 2 118122979 missense probably damaging 1.00
R4576:Thbs1 UTSW 2 118119416 missense probably damaging 0.97
R4596:Thbs1 UTSW 2 118114755 missense possibly damaging 0.80
R4646:Thbs1 UTSW 2 118118329 missense probably benign 0.15
R4783:Thbs1 UTSW 2 118114792 missense probably benign 0.04
R4836:Thbs1 UTSW 2 118115018 missense possibly damaging 0.91
R4943:Thbs1 UTSW 2 118113449 missense probably damaging 1.00
R4967:Thbs1 UTSW 2 118114778 missense probably benign
R5014:Thbs1 UTSW 2 118120037 critical splice donor site probably null
R5062:Thbs1 UTSW 2 118121237 critical splice donor site probably null
R5363:Thbs1 UTSW 2 118122666 missense probably damaging 1.00
R5420:Thbs1 UTSW 2 118113155 missense possibly damaging 0.83
R5432:Thbs1 UTSW 2 118114683 missense probably benign 0.25
R5788:Thbs1 UTSW 2 118122508 missense probably damaging 1.00
R6221:Thbs1 UTSW 2 118119997 missense probably damaging 1.00
R6327:Thbs1 UTSW 2 118112656 missense unknown
R6466:Thbs1 UTSW 2 118119847 missense probably damaging 1.00
R6480:Thbs1 UTSW 2 118119117 missense probably damaging 1.00
R6794:Thbs1 UTSW 2 118120038 splice site probably null
R6983:Thbs1 UTSW 2 118119952 missense probably damaging 1.00
X0019:Thbs1 UTSW 2 118112982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGGCAACCATTTCCAGTAACAG -3'
(R):5'- CGTTGTGATTGAAGCAAGCATCAGG -3'

Sequencing Primer
(F):5'- GTAACAGAGACCCTTCAGTGTC -3'
(R):5'- CAAGCATCAGGCACTTCTTTG -3'
Posted On2014-05-09