Incidental Mutation 'R1571:Kprp'
ID186193
Institutional Source Beutler Lab
Gene Symbol Kprp
Ensembl Gene ENSMUSG00000059832
Gene Namekeratinocyte expressed, proline-rich
Synonyms1110001M24Rik
MMRRC Submission 039610-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R1571 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location92823074-92827247 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 92825382 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 120 (C120*)
Ref Sequence ENSEMBL: ENSMUSP00000072200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072363]
Predicted Effect probably null
Transcript: ENSMUST00000072363
AA Change: C120*
SMART Domains Protein: ENSMUSP00000072200
Gene: ENSMUSG00000059832
AA Change: C120*

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
low complexity region 292 302 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 380 397 N/A INTRINSIC
low complexity region 446 502 N/A INTRINSIC
low complexity region 515 534 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a proline-rich skin protein possibly involved in keratinocyte differentiation. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610524H06Rik A G 5: 114,823,311 probably null Het
Abcd3 T C 3: 121,792,842 I70V possibly damaging Het
Acad10 T C 5: 121,621,348 Y1024C probably damaging Het
Atp2b3 T G X: 73,545,106 V701G probably damaging Het
Cbfa2t2 T A 2: 154,500,427 M21K probably damaging Het
Cdc25a C T 9: 109,881,546 T106I possibly damaging Het
Cdhr5 T C 7: 141,272,170 T190A probably damaging Het
Chl1 A G 6: 103,708,484 T829A probably benign Het
Clcn6 T C 4: 148,012,769 T614A possibly damaging Het
Cntln A T 4: 84,947,586 R160* probably null Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dock3 C A 9: 106,937,959 M1236I possibly damaging Het
Eif4g3 T A 4: 138,120,408 H213Q probably damaging Het
Eya1 T A 1: 14,208,917 H372L probably damaging Het
Fam13b A G 18: 34,497,432 V91A possibly damaging Het
Gm5724 A T 6: 141,754,409 C132* probably null Het
Hat1 T A 2: 71,434,175 I319K probably benign Het
Kcnf1 T C 12: 17,175,852 N123D probably benign Het
Kcns3 C A 12: 11,091,550 G383W probably damaging Het
Lama3 T A 18: 12,539,717 C2456S probably damaging Het
Lrp1b A T 2: 41,476,646 D539E probably damaging Het
Matn3 T C 12: 8,955,466 L292S probably damaging Het
Mbd3l1 T A 9: 18,484,651 I24N probably damaging Het
Med10 T C 13: 69,810,040 L37P probably damaging Het
Mrc1 A T 2: 14,308,733 H925L probably damaging Het
Myo15 T A 11: 60,518,464 I3219N probably damaging Het
Nom1 C T 5: 29,442,635 Q623* probably null Het
Nrm T A 17: 35,864,187 W136R probably damaging Het
Olfr1098 A C 2: 86,923,445 V29G probably benign Het
Pde7b T C 10: 20,413,090 N298S probably benign Het
Piezo2 C T 18: 63,144,919 A305T possibly damaging Het
Pimreg T C 11: 72,045,216 L175P possibly damaging Het
Pkhd1l1 A G 15: 44,526,841 D1451G probably benign Het
Ptpro A G 6: 137,378,130 S212G probably benign Het
Rhpn1 C T 15: 75,714,118 R627C possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnase4 T G 14: 51,105,040 F74V probably damaging Het
Sbno2 A G 10: 80,060,392 probably null Het
Selp T C 1: 164,126,607 Y159H probably damaging Het
Senp6 A G 9: 80,093,571 T21A probably damaging Het
Slco3a1 T C 7: 74,504,380 D148G possibly damaging Het
Smtn G A 11: 3,530,102 P373L probably benign Het
Snx20 A T 8: 88,629,969 L73Q probably damaging Het
Sobp A G 10: 43,157,946 V128A possibly damaging Het
Tcerg1 A G 18: 42,524,292 T280A unknown Het
Tgfbrap1 A G 1: 43,049,813 V810A probably benign Het
Thbs1 C A 2: 118,119,197 D589E probably damaging Het
Tjp2 A G 19: 24,100,875 Y885H probably damaging Het
Tmem109 A G 19: 10,872,629 S100P probably damaging Het
Trim36 T C 18: 46,172,495 K462E probably benign Het
Vmn1r226 A T 17: 20,688,276 I257F probably damaging Het
Vmn2r92 A G 17: 18,152,090 Y54C probably damaging Het
Wdcp T A 12: 4,851,924 Y593* probably null Het
Wdr59 T C 8: 111,451,050 S907G probably damaging Het
Other mutations in Kprp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Kprp APN 3 92824427 missense unknown
IGL01566:Kprp APN 3 92823964 missense probably benign 0.11
R0062:Kprp UTSW 3 92824682 missense probably damaging 1.00
R0062:Kprp UTSW 3 92824682 missense probably damaging 1.00
R0244:Kprp UTSW 3 92825411 missense probably benign 0.06
R0364:Kprp UTSW 3 92824335 nonsense probably null
R0414:Kprp UTSW 3 92825713 missense probably damaging 1.00
R0511:Kprp UTSW 3 92824723 missense probably damaging 1.00
R0555:Kprp UTSW 3 92824357 missense unknown
R0800:Kprp UTSW 3 92825035 missense unknown
R1356:Kprp UTSW 3 92825602 missense probably damaging 1.00
R1550:Kprp UTSW 3 92824726 missense probably damaging 0.96
R1618:Kprp UTSW 3 92825476 missense probably damaging 0.99
R2424:Kprp UTSW 3 92825605 missense probably damaging 1.00
R2680:Kprp UTSW 3 92824463 missense unknown
R3605:Kprp UTSW 3 92824281 missense unknown
R3606:Kprp UTSW 3 92824281 missense unknown
R3607:Kprp UTSW 3 92824281 missense unknown
R3755:Kprp UTSW 3 92825039 missense unknown
R4116:Kprp UTSW 3 92823968 missense probably damaging 1.00
R4204:Kprp UTSW 3 92824739 missense probably damaging 0.99
R4320:Kprp UTSW 3 92824856 missense probably damaging 1.00
R4321:Kprp UTSW 3 92824856 missense probably damaging 1.00
R4323:Kprp UTSW 3 92824856 missense probably damaging 1.00
R4575:Kprp UTSW 3 92823964 missense probably benign 0.11
R4864:Kprp UTSW 3 92824522 missense unknown
R5133:Kprp UTSW 3 92824522 missense unknown
R5583:Kprp UTSW 3 92824336 missense unknown
R5902:Kprp UTSW 3 92824528 missense unknown
R5990:Kprp UTSW 3 92824774 missense probably damaging 1.00
R6198:Kprp UTSW 3 92824687 missense probably damaging 1.00
R6633:Kprp UTSW 3 92825293 missense probably damaging 1.00
R7025:Kprp UTSW 3 92825197 missense probably benign 0.03
R7269:Kprp UTSW 3 92823871 missense probably damaging 0.96
Z1088:Kprp UTSW 3 92825057 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTGTAAGAACGCCGTGACTG -3'
(R):5'- GGCTCCATGTAAGACCACCAAAGG -3'

Sequencing Primer
(F):5'- AGAAGCCTccctggccc -3'
(R):5'- AGGCAAATGCCAGGCCC -3'
Posted On2014-05-09