Incidental Mutation 'R1571:Abcd3'
ID186194
Institutional Source Beutler Lab
Gene Symbol Abcd3
Ensembl Gene ENSMUSG00000028127
Gene NameATP-binding cassette, sub-family D (ALD), member 3
SynonymsPMP70, Pxmp1
MMRRC Submission 039610-MU
Accession Numbers

Genbank: NM_008991; MGI: 1349216

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1571 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location121758774-121815302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121792842 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 70 (I70V)
Ref Sequence ENSEMBL: ENSMUSP00000142387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029770] [ENSMUST00000197383] [ENSMUST00000197662]
Predicted Effect probably benign
Transcript: ENSMUST00000029770
AA Change: I70V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000029770
Gene: ENSMUSG00000028127
AA Change: I70V

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
Pfam:ABC_membrane_2 57 338 8.6e-106 PFAM
AAA 465 640 6.88e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195965
Predicted Effect possibly damaging
Transcript: ENSMUST00000197383
AA Change: I70V

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142387
Gene: ENSMUSG00000028127
AA Change: I70V

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:ABC_membrane_2 57 277 2.3e-78 PFAM
AAA 355 530 1.1e-7 SMART
Predicted Effect silent
Transcript: ENSMUST00000197662
SMART Domains Protein: ENSMUSP00000143487
Gene: ENSMUSG00000028127

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199593
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. This peroxisomal membrane protein likely plays an important role in peroxisome biogenesis. Mutations have been associated with some forms of Zellweger syndrome, a heterogeneous group of peroxisome assembly disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show enlarged livers, abnormal bile composition and peroxisome abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610524H06Rik A G 5: 114,823,311 probably null Het
Acad10 T C 5: 121,621,348 Y1024C probably damaging Het
Atp2b3 T G X: 73,545,106 V701G probably damaging Het
Cbfa2t2 T A 2: 154,500,427 M21K probably damaging Het
Cdc25a C T 9: 109,881,546 T106I possibly damaging Het
Cdhr5 T C 7: 141,272,170 T190A probably damaging Het
Chl1 A G 6: 103,708,484 T829A probably benign Het
Clcn6 T C 4: 148,012,769 T614A possibly damaging Het
Cntln A T 4: 84,947,586 R160* probably null Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dock3 C A 9: 106,937,959 M1236I possibly damaging Het
Eif4g3 T A 4: 138,120,408 H213Q probably damaging Het
Eya1 T A 1: 14,208,917 H372L probably damaging Het
Fam13b A G 18: 34,497,432 V91A possibly damaging Het
Gm5724 A T 6: 141,754,409 C132* probably null Het
Hat1 T A 2: 71,434,175 I319K probably benign Het
Kcnf1 T C 12: 17,175,852 N123D probably benign Het
Kcns3 C A 12: 11,091,550 G383W probably damaging Het
Kprp A T 3: 92,825,382 C120* probably null Het
Lama3 T A 18: 12,539,717 C2456S probably damaging Het
Lrp1b A T 2: 41,476,646 D539E probably damaging Het
Matn3 T C 12: 8,955,466 L292S probably damaging Het
Mbd3l1 T A 9: 18,484,651 I24N probably damaging Het
Med10 T C 13: 69,810,040 L37P probably damaging Het
Mrc1 A T 2: 14,308,733 H925L probably damaging Het
Myo15 T A 11: 60,518,464 I3219N probably damaging Het
Nom1 C T 5: 29,442,635 Q623* probably null Het
Nrm T A 17: 35,864,187 W136R probably damaging Het
Olfr1098 A C 2: 86,923,445 V29G probably benign Het
Pde7b T C 10: 20,413,090 N298S probably benign Het
Piezo2 C T 18: 63,144,919 A305T possibly damaging Het
Pimreg T C 11: 72,045,216 L175P possibly damaging Het
Pkhd1l1 A G 15: 44,526,841 D1451G probably benign Het
Ptpro A G 6: 137,378,130 S212G probably benign Het
Rhpn1 C T 15: 75,714,118 R627C possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnase4 T G 14: 51,105,040 F74V probably damaging Het
Sbno2 A G 10: 80,060,392 probably null Het
Selp T C 1: 164,126,607 Y159H probably damaging Het
Senp6 A G 9: 80,093,571 T21A probably damaging Het
Slco3a1 T C 7: 74,504,380 D148G possibly damaging Het
Smtn G A 11: 3,530,102 P373L probably benign Het
Snx20 A T 8: 88,629,969 L73Q probably damaging Het
Sobp A G 10: 43,157,946 V128A possibly damaging Het
Tcerg1 A G 18: 42,524,292 T280A unknown Het
Tgfbrap1 A G 1: 43,049,813 V810A probably benign Het
Thbs1 C A 2: 118,119,197 D589E probably damaging Het
Tjp2 A G 19: 24,100,875 Y885H probably damaging Het
Tmem109 A G 19: 10,872,629 S100P probably damaging Het
Trim36 T C 18: 46,172,495 K462E probably benign Het
Vmn1r226 A T 17: 20,688,276 I257F probably damaging Het
Vmn2r92 A G 17: 18,152,090 Y54C probably damaging Het
Wdcp T A 12: 4,851,924 Y593* probably null Het
Wdr59 T C 8: 111,451,050 S907G probably damaging Het
Other mutations in Abcd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Abcd3 APN 3 121776993 splice site probably benign
IGL00670:Abcd3 APN 3 121775684 missense probably damaging 1.00
IGL02473:Abcd3 APN 3 121769244 missense possibly damaging 0.74
IGL02660:Abcd3 APN 3 121784020 missense probably damaging 1.00
IGL02993:Abcd3 APN 3 121774010 missense probably benign 0.01
IGL03131:Abcd3 APN 3 121781991 splice site probably benign
3-1:Abcd3 UTSW 3 121760300 missense probably benign
R0324:Abcd3 UTSW 3 121769167 missense probably null 0.00
R0599:Abcd3 UTSW 3 121765093 missense probably damaging 1.00
R0682:Abcd3 UTSW 3 121769567 missense possibly damaging 0.90
R1109:Abcd3 UTSW 3 121779596 missense probably damaging 1.00
R1453:Abcd3 UTSW 3 121765061 missense probably damaging 1.00
R1544:Abcd3 UTSW 3 121784473 missense probably benign 0.11
R1779:Abcd3 UTSW 3 121781963 missense probably damaging 1.00
R2429:Abcd3 UTSW 3 121792863 missense probably damaging 1.00
R4326:Abcd3 UTSW 3 121761470 missense probably benign 0.06
R4676:Abcd3 UTSW 3 121774166 missense possibly damaging 0.69
R4830:Abcd3 UTSW 3 121760284 missense probably damaging 1.00
R4929:Abcd3 UTSW 3 121768746 splice site probably null
R4980:Abcd3 UTSW 3 121769268 splice site probably null
R5052:Abcd3 UTSW 3 121769513 critical splice donor site probably null
R5384:Abcd3 UTSW 3 121761410 splice site probably null
R5616:Abcd3 UTSW 3 121772360 missense probably benign 0.00
R5796:Abcd3 UTSW 3 121784498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTACTGGGGAAAACGGGGCTAAC -3'
(R):5'- TGTCGCAGTTCCCTTAGATGTGATTC -3'

Sequencing Primer
(F):5'- GGGATGTCACATCATCAATACTGG -3'
(R):5'- tcgttacggatggttgtgag -3'
Posted On2014-05-09