Incidental Mutation 'R1571:Cntln'
ID186195
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Namecentlein, centrosomal protein
SynonymsB430108F07Rik, D530005L17Rik
MMRRC Submission 039610-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock #R1571 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location84884309-85131921 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 84947586 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 160 (R160*)
Ref Sequence ENSEMBL: ENSMUSP00000130491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000102819] [ENSMUST00000169371]
Predicted Effect probably null
Transcript: ENSMUST00000047023
AA Change: R160*
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: R160*

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102819
AA Change: R160*
SMART Domains Protein: ENSMUSP00000099883
Gene: ENSMUSG00000038070
AA Change: R160*

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
coiled coil region 166 277 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169371
AA Change: R160*
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: R160*

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610524H06Rik A G 5: 114,823,311 probably null Het
Abcd3 T C 3: 121,792,842 I70V possibly damaging Het
Acad10 T C 5: 121,621,348 Y1024C probably damaging Het
Atp2b3 T G X: 73,545,106 V701G probably damaging Het
Cbfa2t2 T A 2: 154,500,427 M21K probably damaging Het
Cdc25a C T 9: 109,881,546 T106I possibly damaging Het
Cdhr5 T C 7: 141,272,170 T190A probably damaging Het
Chl1 A G 6: 103,708,484 T829A probably benign Het
Clcn6 T C 4: 148,012,769 T614A possibly damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dock3 C A 9: 106,937,959 M1236I possibly damaging Het
Eif4g3 T A 4: 138,120,408 H213Q probably damaging Het
Eya1 T A 1: 14,208,917 H372L probably damaging Het
Fam13b A G 18: 34,497,432 V91A possibly damaging Het
Gm5724 A T 6: 141,754,409 C132* probably null Het
Hat1 T A 2: 71,434,175 I319K probably benign Het
Kcnf1 T C 12: 17,175,852 N123D probably benign Het
Kcns3 C A 12: 11,091,550 G383W probably damaging Het
Kprp A T 3: 92,825,382 C120* probably null Het
Lama3 T A 18: 12,539,717 C2456S probably damaging Het
Lrp1b A T 2: 41,476,646 D539E probably damaging Het
Matn3 T C 12: 8,955,466 L292S probably damaging Het
Mbd3l1 T A 9: 18,484,651 I24N probably damaging Het
Med10 T C 13: 69,810,040 L37P probably damaging Het
Mrc1 A T 2: 14,308,733 H925L probably damaging Het
Myo15 T A 11: 60,518,464 I3219N probably damaging Het
Nom1 C T 5: 29,442,635 Q623* probably null Het
Nrm T A 17: 35,864,187 W136R probably damaging Het
Olfr1098 A C 2: 86,923,445 V29G probably benign Het
Pde7b T C 10: 20,413,090 N298S probably benign Het
Piezo2 C T 18: 63,144,919 A305T possibly damaging Het
Pimreg T C 11: 72,045,216 L175P possibly damaging Het
Pkhd1l1 A G 15: 44,526,841 D1451G probably benign Het
Ptpro A G 6: 137,378,130 S212G probably benign Het
Rhpn1 C T 15: 75,714,118 R627C possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnase4 T G 14: 51,105,040 F74V probably damaging Het
Sbno2 A G 10: 80,060,392 probably null Het
Selp T C 1: 164,126,607 Y159H probably damaging Het
Senp6 A G 9: 80,093,571 T21A probably damaging Het
Slco3a1 T C 7: 74,504,380 D148G possibly damaging Het
Smtn G A 11: 3,530,102 P373L probably benign Het
Snx20 A T 8: 88,629,969 L73Q probably damaging Het
Sobp A G 10: 43,157,946 V128A possibly damaging Het
Tcerg1 A G 18: 42,524,292 T280A unknown Het
Tgfbrap1 A G 1: 43,049,813 V810A probably benign Het
Thbs1 C A 2: 118,119,197 D589E probably damaging Het
Tjp2 A G 19: 24,100,875 Y885H probably damaging Het
Tmem109 A G 19: 10,872,629 S100P probably damaging Het
Trim36 T C 18: 46,172,495 K462E probably benign Het
Vmn1r226 A T 17: 20,688,276 I257F probably damaging Het
Vmn2r92 A G 17: 18,152,090 Y54C probably damaging Het
Wdcp T A 12: 4,851,924 Y593* probably null Het
Wdr59 T C 8: 111,451,050 S907G probably damaging Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 85006434 missense probably benign 0.25
IGL00743:Cntln APN 4 84979415 missense probably benign 0.06
IGL01014:Cntln APN 4 85049908 missense probably benign 0.25
IGL02217:Cntln APN 4 85100258 missense probably damaging 1.00
IGL02323:Cntln APN 4 85049789 missense probably benign 0.00
IGL02353:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02360:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02616:Cntln APN 4 85115452 critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84974000 missense probably damaging 0.99
R0110:Cntln UTSW 4 85096757 missense probably damaging 1.00
R0324:Cntln UTSW 4 85092695 missense probably damaging 0.98
R0349:Cntln UTSW 4 84996485 missense probably damaging 1.00
R0519:Cntln UTSW 4 85005053 splice site probably benign
R0529:Cntln UTSW 4 85067825 missense probably damaging 1.00
R0582:Cntln UTSW 4 84884741 missense probably damaging 1.00
R1077:Cntln UTSW 4 84996479 missense probably damaging 1.00
R1345:Cntln UTSW 4 84973991 missense probably damaging 1.00
R1457:Cntln UTSW 4 85096839 missense probably benign 0.33
R1622:Cntln UTSW 4 85063181 missense probably damaging 1.00
R1681:Cntln UTSW 4 84947635 missense probably damaging 1.00
R1777:Cntln UTSW 4 85130679 missense probably benign 0.23
R1808:Cntln UTSW 4 85096763 missense probably damaging 1.00
R1882:Cntln UTSW 4 85100835 missense probably damaging 1.00
R2056:Cntln UTSW 4 85049674 missense probably benign
R2965:Cntln UTSW 4 84974027 critical splice donor site probably null
R2968:Cntln UTSW 4 84957267 missense probably benign 0.27
R3104:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3106:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3121:Cntln UTSW 4 85005052 splice site probably benign
R3617:Cntln UTSW 4 85004977 nonsense probably null
R4009:Cntln UTSW 4 85063215 missense probably benign 0.45
R4036:Cntln UTSW 4 85006488 missense probably damaging 1.00
R4548:Cntln UTSW 4 85096842 missense probably benign 0.27
R4592:Cntln UTSW 4 84971182 missense probably benign 0.00
R4666:Cntln UTSW 4 84971216 missense probably benign 0.13
R4826:Cntln UTSW 4 85005044 missense probably benign 0.03
R4836:Cntln UTSW 4 85049720 nonsense probably null
R4856:Cntln UTSW 4 84971229 missense probably benign 0.35
R4886:Cntln UTSW 4 84971229 missense probably benign 0.35
R4995:Cntln UTSW 4 85049883 missense probably benign 0.00
R5090:Cntln UTSW 4 84947593 missense probably damaging 0.98
R5202:Cntln UTSW 4 84971229 missense probably benign 0.35
R5905:Cntln UTSW 4 84971173 missense probably benign 0.03
R5953:Cntln UTSW 4 85049919 missense possibly damaging 0.92
R6028:Cntln UTSW 4 84971173 missense probably benign 0.03
R6298:Cntln UTSW 4 85096761 missense probably damaging 1.00
R6351:Cntln UTSW 4 85115354 missense probably damaging 0.99
R6371:Cntln UTSW 4 84884579 missense probably damaging 0.98
R6481:Cntln UTSW 4 85067510 missense probably benign 0.00
R6864:Cntln UTSW 4 85096792 missense probably damaging 0.99
R6874:Cntln UTSW 4 85067759 missense probably damaging 1.00
R6919:Cntln UTSW 4 85115368 missense probably benign 0.04
R7071:Cntln UTSW 4 85100385 missense probably damaging 1.00
R7113:Cntln UTSW 4 85049827 missense probably damaging 0.98
R7152:Cntln UTSW 4 84884700 missense possibly damaging 0.87
R7253:Cntln UTSW 4 85118473 missense probably damaging 1.00
R7289:Cntln UTSW 4 85046303 missense possibly damaging 0.80
R7440:Cntln UTSW 4 85063216 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACTGTGGACATTTAAAGGAGCGGC -3'
(R):5'- ACCCTCACAGGCTCATTAGATGGAG -3'

Sequencing Primer
(F):5'- ggctgggagagtggtagag -3'
(R):5'- AGCTCAGCTACAGGCATTTC -3'
Posted On2014-05-09