Incidental Mutation 'R1571:Nom1'
ID186199
Institutional Source Beutler Lab
Gene Symbol Nom1
Ensembl Gene ENSMUSG00000001569
Gene Namenucleolar protein with MIF4G domain 1
SynonymsGm1040, LOC381627, D5Kng1
MMRRC Submission 039610-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1571 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location29434664-29457843 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 29442635 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 623 (Q623*)
Ref Sequence ENSEMBL: ENSMUSP00000001611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001611]
Predicted Effect probably null
Transcript: ENSMUST00000001611
AA Change: Q623*
SMART Domains Protein: ENSMUSP00000001611
Gene: ENSMUSG00000001569
AA Change: Q623*

DomainStartEndE-ValueType
low complexity region 79 98 N/A INTRINSIC
low complexity region 102 114 N/A INTRINSIC
low complexity region 119 147 N/A INTRINSIC
coiled coil region 170 197 N/A INTRINSIC
low complexity region 227 250 N/A INTRINSIC
low complexity region 311 326 N/A INTRINSIC
MIF4G 356 553 1.1e-21 SMART
MA3 649 755 1.59e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146347
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that contain MIF4G (middle of eIF4G (MIM 600495)) and/or MA3 domains, such as NOM1, function in protein translation. These domains include binding sites for members of the EIF4A family of ATP-dependent DEAD box RNA helicases (see EIF4A1; MIM 602641) (Simmons et al., 2005 [PubMed 15715967]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610524H06Rik A G 5: 114,823,311 probably null Het
Abcd3 T C 3: 121,792,842 I70V possibly damaging Het
Acad10 T C 5: 121,621,348 Y1024C probably damaging Het
Atp2b3 T G X: 73,545,106 V701G probably damaging Het
Cbfa2t2 T A 2: 154,500,427 M21K probably damaging Het
Cdc25a C T 9: 109,881,546 T106I possibly damaging Het
Cdhr5 T C 7: 141,272,170 T190A probably damaging Het
Chl1 A G 6: 103,708,484 T829A probably benign Het
Clcn6 T C 4: 148,012,769 T614A possibly damaging Het
Cntln A T 4: 84,947,586 R160* probably null Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dock3 C A 9: 106,937,959 M1236I possibly damaging Het
Eif4g3 T A 4: 138,120,408 H213Q probably damaging Het
Eya1 T A 1: 14,208,917 H372L probably damaging Het
Fam13b A G 18: 34,497,432 V91A possibly damaging Het
Gm5724 A T 6: 141,754,409 C132* probably null Het
Hat1 T A 2: 71,434,175 I319K probably benign Het
Kcnf1 T C 12: 17,175,852 N123D probably benign Het
Kcns3 C A 12: 11,091,550 G383W probably damaging Het
Kprp A T 3: 92,825,382 C120* probably null Het
Lama3 T A 18: 12,539,717 C2456S probably damaging Het
Lrp1b A T 2: 41,476,646 D539E probably damaging Het
Matn3 T C 12: 8,955,466 L292S probably damaging Het
Mbd3l1 T A 9: 18,484,651 I24N probably damaging Het
Med10 T C 13: 69,810,040 L37P probably damaging Het
Mrc1 A T 2: 14,308,733 H925L probably damaging Het
Myo15 T A 11: 60,518,464 I3219N probably damaging Het
Nrm T A 17: 35,864,187 W136R probably damaging Het
Olfr1098 A C 2: 86,923,445 V29G probably benign Het
Pde7b T C 10: 20,413,090 N298S probably benign Het
Piezo2 C T 18: 63,144,919 A305T possibly damaging Het
Pimreg T C 11: 72,045,216 L175P possibly damaging Het
Pkhd1l1 A G 15: 44,526,841 D1451G probably benign Het
Ptpro A G 6: 137,378,130 S212G probably benign Het
Rhpn1 C T 15: 75,714,118 R627C possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnase4 T G 14: 51,105,040 F74V probably damaging Het
Sbno2 A G 10: 80,060,392 probably null Het
Selp T C 1: 164,126,607 Y159H probably damaging Het
Senp6 A G 9: 80,093,571 T21A probably damaging Het
Slco3a1 T C 7: 74,504,380 D148G possibly damaging Het
Smtn G A 11: 3,530,102 P373L probably benign Het
Snx20 A T 8: 88,629,969 L73Q probably damaging Het
Sobp A G 10: 43,157,946 V128A possibly damaging Het
Tcerg1 A G 18: 42,524,292 T280A unknown Het
Tgfbrap1 A G 1: 43,049,813 V810A probably benign Het
Thbs1 C A 2: 118,119,197 D589E probably damaging Het
Tjp2 A G 19: 24,100,875 Y885H probably damaging Het
Tmem109 A G 19: 10,872,629 S100P probably damaging Het
Trim36 T C 18: 46,172,495 K462E probably benign Het
Vmn1r226 A T 17: 20,688,276 I257F probably damaging Het
Vmn2r92 A G 17: 18,152,090 Y54C probably damaging Het
Wdcp T A 12: 4,851,924 Y593* probably null Het
Wdr59 T C 8: 111,451,050 S907G probably damaging Het
Other mutations in Nom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Nom1 APN 5 29446274 missense possibly damaging 0.74
IGL01795:Nom1 APN 5 29446871 missense probably benign 0.06
IGL02308:Nom1 APN 5 29437710 missense probably damaging 1.00
IGL02378:Nom1 APN 5 29451126 nonsense probably null
IGL02506:Nom1 APN 5 29439816 splice site probably benign
R0633:Nom1 UTSW 5 29451100 missense probably damaging 1.00
R0652:Nom1 UTSW 5 29435311 missense probably damaging 1.00
R1707:Nom1 UTSW 5 29435318 missense probably damaging 0.99
R1852:Nom1 UTSW 5 29446878 missense possibly damaging 0.46
R2025:Nom1 UTSW 5 29446851 missense probably damaging 1.00
R2196:Nom1 UTSW 5 29436021 missense probably benign 0.00
R2207:Nom1 UTSW 5 29439974 missense probably damaging 1.00
R2256:Nom1 UTSW 5 29437752 missense probably damaging 1.00
R2257:Nom1 UTSW 5 29437752 missense probably damaging 1.00
R2680:Nom1 UTSW 5 29443417 missense probably damaging 1.00
R3439:Nom1 UTSW 5 29435617 missense probably benign 0.01
R4291:Nom1 UTSW 5 29446372 critical splice donor site probably null
R4587:Nom1 UTSW 5 29451165 missense possibly damaging 0.91
R5374:Nom1 UTSW 5 29441379 missense probably damaging 1.00
R5761:Nom1 UTSW 5 29437641 missense probably damaging 1.00
R5772:Nom1 UTSW 5 29446875 missense possibly damaging 0.81
R5828:Nom1 UTSW 5 29435126 missense possibly damaging 0.53
R5963:Nom1 UTSW 5 29437770 missense probably damaging 1.00
R6208:Nom1 UTSW 5 29449619 missense possibly damaging 0.83
R7234:Nom1 UTSW 5 29435453 missense probably benign 0.01
R7476:Nom1 UTSW 5 29442536 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CGTGACAGAAGTGCAGGTGTGAATC -3'
(R):5'- TGCTGAGTTCCAACAACAGCTCC -3'

Sequencing Primer
(F):5'- TCCTGGGATGGCATCTTGAA -3'
(R):5'- CATAGGCTCACATGAGCTATTTC -3'
Posted On2014-05-09