Incidental Mutation 'R1571:Slco3a1'
ID186205
Institutional Source Beutler Lab
Gene Symbol Slco3a1
Ensembl Gene ENSMUSG00000025790
Gene Namesolute carrier organic anion transporter family, member 3a1
SynonymsOATP-D, Slc21a11, 5830414C08Rik, MJAM, Anr1
MMRRC Submission 039610-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R1571 (G1)
Quality Score210
Status Not validated
Chromosome7
Chromosomal Location74275419-74554780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74504380 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 148 (D148G)
Ref Sequence ENSEMBL: ENSMUSP00000103077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026897] [ENSMUST00000098371] [ENSMUST00000107453] [ENSMUST00000138099]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026897
AA Change: D148G

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000026897
Gene: ENSMUSG00000025790
AA Change: D148G

DomainStartEndE-ValueType
low complexity region 7 16 N/A INTRINSIC
Pfam:MFS_1 44 455 1.2e-27 PFAM
KAZAL 474 509 2.77e-1 SMART
low complexity region 574 594 N/A INTRINSIC
transmembrane domain 626 648 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098371
AA Change: D148G

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095973
Gene: ENSMUSG00000025790
AA Change: D148G

DomainStartEndE-ValueType
low complexity region 7 16 N/A INTRINSIC
Pfam:MFS_1 44 456 1.2e-27 PFAM
KAZAL 474 509 2.77e-1 SMART
low complexity region 574 594 N/A INTRINSIC
transmembrane domain 626 648 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107453
AA Change: D148G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103077
Gene: ENSMUSG00000025790
AA Change: D148G

DomainStartEndE-ValueType
low complexity region 7 16 N/A INTRINSIC
Pfam:MFS_1 45 456 2e-27 PFAM
KAZAL 474 509 2.77e-1 SMART
low complexity region 574 589 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129292
Predicted Effect unknown
Transcript: ENSMUST00000134539
AA Change: D109G
SMART Domains Protein: ENSMUSP00000116946
Gene: ENSMUSG00000025790
AA Change: D109G

DomainStartEndE-ValueType
Pfam:OATP 3 181 1.6e-56 PFAM
Pfam:MFS_1 6 183 3.3e-10 PFAM
Pfam:OATP 179 219 2.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136389
Predicted Effect probably benign
Transcript: ENSMUST00000138099
AA Change: D119G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115279
Gene: ENSMUSG00000025790
AA Change: D119G

DomainStartEndE-ValueType
Pfam:OATP 26 165 2.4e-47 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610524H06Rik A G 5: 114,823,311 probably null Het
Abcd3 T C 3: 121,792,842 I70V possibly damaging Het
Acad10 T C 5: 121,621,348 Y1024C probably damaging Het
Atp2b3 T G X: 73,545,106 V701G probably damaging Het
Cbfa2t2 T A 2: 154,500,427 M21K probably damaging Het
Cdc25a C T 9: 109,881,546 T106I possibly damaging Het
Cdhr5 T C 7: 141,272,170 T190A probably damaging Het
Chl1 A G 6: 103,708,484 T829A probably benign Het
Clcn6 T C 4: 148,012,769 T614A possibly damaging Het
Cntln A T 4: 84,947,586 R160* probably null Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dock3 C A 9: 106,937,959 M1236I possibly damaging Het
Eif4g3 T A 4: 138,120,408 H213Q probably damaging Het
Eya1 T A 1: 14,208,917 H372L probably damaging Het
Fam13b A G 18: 34,497,432 V91A possibly damaging Het
Gm5724 A T 6: 141,754,409 C132* probably null Het
Hat1 T A 2: 71,434,175 I319K probably benign Het
Kcnf1 T C 12: 17,175,852 N123D probably benign Het
Kcns3 C A 12: 11,091,550 G383W probably damaging Het
Kprp A T 3: 92,825,382 C120* probably null Het
Lama3 T A 18: 12,539,717 C2456S probably damaging Het
Lrp1b A T 2: 41,476,646 D539E probably damaging Het
Matn3 T C 12: 8,955,466 L292S probably damaging Het
Mbd3l1 T A 9: 18,484,651 I24N probably damaging Het
Med10 T C 13: 69,810,040 L37P probably damaging Het
Mrc1 A T 2: 14,308,733 H925L probably damaging Het
Myo15 T A 11: 60,518,464 I3219N probably damaging Het
Nom1 C T 5: 29,442,635 Q623* probably null Het
Nrm T A 17: 35,864,187 W136R probably damaging Het
Olfr1098 A C 2: 86,923,445 V29G probably benign Het
Pde7b T C 10: 20,413,090 N298S probably benign Het
Piezo2 C T 18: 63,144,919 A305T possibly damaging Het
Pimreg T C 11: 72,045,216 L175P possibly damaging Het
Pkhd1l1 A G 15: 44,526,841 D1451G probably benign Het
Ptpro A G 6: 137,378,130 S212G probably benign Het
Rhpn1 C T 15: 75,714,118 R627C possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnase4 T G 14: 51,105,040 F74V probably damaging Het
Sbno2 A G 10: 80,060,392 probably null Het
Selp T C 1: 164,126,607 Y159H probably damaging Het
Senp6 A G 9: 80,093,571 T21A probably damaging Het
Smtn G A 11: 3,530,102 P373L probably benign Het
Snx20 A T 8: 88,629,969 L73Q probably damaging Het
Sobp A G 10: 43,157,946 V128A possibly damaging Het
Tcerg1 A G 18: 42,524,292 T280A unknown Het
Tgfbrap1 A G 1: 43,049,813 V810A probably benign Het
Thbs1 C A 2: 118,119,197 D589E probably damaging Het
Tjp2 A G 19: 24,100,875 Y885H probably damaging Het
Tmem109 A G 19: 10,872,629 S100P probably damaging Het
Trim36 T C 18: 46,172,495 K462E probably benign Het
Vmn1r226 A T 17: 20,688,276 I257F probably damaging Het
Vmn2r92 A G 17: 18,152,090 Y54C probably damaging Het
Wdcp T A 12: 4,851,924 Y593* probably null Het
Wdr59 T C 8: 111,451,050 S907G probably damaging Het
Other mutations in Slco3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Slco3a1 APN 7 74504183 missense probably damaging 1.00
IGL01124:Slco3a1 APN 7 74284547 missense probably damaging 1.00
IGL01583:Slco3a1 APN 7 74284450 missense probably benign 0.01
IGL01929:Slco3a1 APN 7 74318605 splice site probably benign
IGL01991:Slco3a1 APN 7 74284396 missense possibly damaging 0.84
IGL02380:Slco3a1 APN 7 74554490 missense probably damaging 1.00
IGL03269:Slco3a1 APN 7 74318532 missense possibly damaging 0.58
R0052:Slco3a1 UTSW 7 74504326 missense probably benign 0.00
R0052:Slco3a1 UTSW 7 74504326 missense probably benign 0.00
R0317:Slco3a1 UTSW 7 74504426 missense probably damaging 1.00
R0545:Slco3a1 UTSW 7 74320553 nonsense probably null
R0613:Slco3a1 UTSW 7 74346634 unclassified probably benign
R1488:Slco3a1 UTSW 7 74346701 missense possibly damaging 0.94
R1506:Slco3a1 UTSW 7 74359935 intron probably null
R1912:Slco3a1 UTSW 7 74504611 missense probably damaging 1.00
R2011:Slco3a1 UTSW 7 74346671 missense probably benign 0.08
R2382:Slco3a1 UTSW 7 74346776 missense probably benign 0.00
R3735:Slco3a1 UTSW 7 74504497 missense probably damaging 1.00
R3894:Slco3a1 UTSW 7 74284613 missense probably damaging 1.00
R4151:Slco3a1 UTSW 7 74359838 missense probably damaging 1.00
R4175:Slco3a1 UTSW 7 74318554 missense probably damaging 0.97
R4303:Slco3a1 UTSW 7 74554528 missense probably benign 0.03
R4462:Slco3a1 UTSW 7 74554563 missense probably benign 0.18
R4702:Slco3a1 UTSW 7 74320567 missense probably damaging 0.98
R4896:Slco3a1 UTSW 7 74320556 missense probably null 1.00
R5419:Slco3a1 UTSW 7 74284615 missense possibly damaging 0.77
R5561:Slco3a1 UTSW 7 74318499 missense possibly damaging 0.67
R5597:Slco3a1 UTSW 7 74284462 missense probably benign 0.31
R5698:Slco3a1 UTSW 7 74346818 missense probably damaging 1.00
R6086:Slco3a1 UTSW 7 74318590 missense possibly damaging 0.64
R6117:Slco3a1 UTSW 7 74318506 missense probably benign 0.02
R6118:Slco3a1 UTSW 7 74318506 missense probably benign 0.02
R6123:Slco3a1 UTSW 7 74318506 missense probably benign 0.02
R6124:Slco3a1 UTSW 7 74318506 missense probably benign 0.02
R6125:Slco3a1 UTSW 7 74318506 missense probably benign 0.02
R7147:Slco3a1 UTSW 7 74504294 missense not run
X0017:Slco3a1 UTSW 7 74284360 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGGTCCAACTTTGCACCACTACAC -3'
(R):5'- ATCGCCAGCAGCTTTGAGATCG -3'

Sequencing Primer
(F):5'- ATGTAGAGCGAGGAGTCCTTTC -3'
(R):5'- CAGCTTTGAGATCGGCAAC -3'
Posted On2014-05-09