Incidental Mutation 'R1571:Kcns3'
ID186223
Institutional Source Beutler Lab
Gene Symbol Kcns3
Ensembl Gene ENSMUSG00000043673
Gene Namepotassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
SynonymsD12Ertd137e
MMRRC Submission 039610-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R1571 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location11090202-11151056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 11091550 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 383 (G383W)
Ref Sequence ENSEMBL: ENSMUSP00000152026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055673] [ENSMUST00000164495] [ENSMUST00000217974]
Predicted Effect probably damaging
Transcript: ENSMUST00000055673
AA Change: G383W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060706
Gene: ENSMUSG00000043673
AA Change: G383W

DomainStartEndE-ValueType
BTB 15 124 1.2e-12 SMART
low complexity region 144 162 N/A INTRINSIC
Pfam:Ion_trans 184 417 5.2e-47 PFAM
Pfam:Ion_trans_2 325 411 3.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164495
AA Change: G383W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129412
Gene: ENSMUSG00000043673
AA Change: G383W

DomainStartEndE-ValueType
BTB 15 124 1.2e-12 SMART
low complexity region 144 162 N/A INTRINSIC
Pfam:Ion_trans 184 417 5.2e-47 PFAM
Pfam:Ion_trans_2 325 411 3.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217974
AA Change: G383W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium channels form the largest and most diversified class of ion channels and are present in both excitable and nonexcitable cells. Their main functions are associated with the regulation of the resting membrane potential and the control of the shape and frequency of action potentials. The alpha subunits are of 2 types: those that are functional by themselves and those that are electrically silent but capable of modulating the activity of specific functional alpha subunits. The protein encoded by this gene is not functional by itself but can form heteromultimers with member 1 and with member 2 (and possibly other members) of the Shab-related subfamily of potassium voltage-gated channel proteins. This gene belongs to the S subfamily of the potassium channel family. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610524H06Rik A G 5: 114,823,311 probably null Het
Abcd3 T C 3: 121,792,842 I70V possibly damaging Het
Acad10 T C 5: 121,621,348 Y1024C probably damaging Het
Atp2b3 T G X: 73,545,106 V701G probably damaging Het
Cbfa2t2 T A 2: 154,500,427 M21K probably damaging Het
Cdc25a C T 9: 109,881,546 T106I possibly damaging Het
Cdhr5 T C 7: 141,272,170 T190A probably damaging Het
Chl1 A G 6: 103,708,484 T829A probably benign Het
Clcn6 T C 4: 148,012,769 T614A possibly damaging Het
Cntln A T 4: 84,947,586 R160* probably null Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dock3 C A 9: 106,937,959 M1236I possibly damaging Het
Eif4g3 T A 4: 138,120,408 H213Q probably damaging Het
Eya1 T A 1: 14,208,917 H372L probably damaging Het
Fam13b A G 18: 34,497,432 V91A possibly damaging Het
Gm5724 A T 6: 141,754,409 C132* probably null Het
Hat1 T A 2: 71,434,175 I319K probably benign Het
Kcnf1 T C 12: 17,175,852 N123D probably benign Het
Kprp A T 3: 92,825,382 C120* probably null Het
Lama3 T A 18: 12,539,717 C2456S probably damaging Het
Lrp1b A T 2: 41,476,646 D539E probably damaging Het
Matn3 T C 12: 8,955,466 L292S probably damaging Het
Mbd3l1 T A 9: 18,484,651 I24N probably damaging Het
Med10 T C 13: 69,810,040 L37P probably damaging Het
Mrc1 A T 2: 14,308,733 H925L probably damaging Het
Myo15 T A 11: 60,518,464 I3219N probably damaging Het
Nom1 C T 5: 29,442,635 Q623* probably null Het
Nrm T A 17: 35,864,187 W136R probably damaging Het
Olfr1098 A C 2: 86,923,445 V29G probably benign Het
Pde7b T C 10: 20,413,090 N298S probably benign Het
Piezo2 C T 18: 63,144,919 A305T possibly damaging Het
Pimreg T C 11: 72,045,216 L175P possibly damaging Het
Pkhd1l1 A G 15: 44,526,841 D1451G probably benign Het
Ptpro A G 6: 137,378,130 S212G probably benign Het
Rhpn1 C T 15: 75,714,118 R627C possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnase4 T G 14: 51,105,040 F74V probably damaging Het
Sbno2 A G 10: 80,060,392 probably null Het
Selp T C 1: 164,126,607 Y159H probably damaging Het
Senp6 A G 9: 80,093,571 T21A probably damaging Het
Slco3a1 T C 7: 74,504,380 D148G possibly damaging Het
Smtn G A 11: 3,530,102 P373L probably benign Het
Snx20 A T 8: 88,629,969 L73Q probably damaging Het
Sobp A G 10: 43,157,946 V128A possibly damaging Het
Tcerg1 A G 18: 42,524,292 T280A unknown Het
Tgfbrap1 A G 1: 43,049,813 V810A probably benign Het
Thbs1 C A 2: 118,119,197 D589E probably damaging Het
Tjp2 A G 19: 24,100,875 Y885H probably damaging Het
Tmem109 A G 19: 10,872,629 S100P probably damaging Het
Trim36 T C 18: 46,172,495 K462E probably benign Het
Vmn1r226 A T 17: 20,688,276 I257F probably damaging Het
Vmn2r92 A G 17: 18,152,090 Y54C probably damaging Het
Wdcp T A 12: 4,851,924 Y593* probably null Het
Wdr59 T C 8: 111,451,050 S907G probably damaging Het
Other mutations in Kcns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Kcns3 APN 12 11092426 missense probably benign 0.40
IGL01089:Kcns3 APN 12 11091571 missense possibly damaging 0.92
IGL01448:Kcns3 APN 12 11091643 missense possibly damaging 0.91
IGL02084:Kcns3 APN 12 11092194 missense probably damaging 0.96
IGL02229:Kcns3 APN 12 11092092 missense probably damaging 1.00
IGL02730:Kcns3 APN 12 11092075 missense probably benign
IGL02820:Kcns3 APN 12 11091871 missense probably benign 0.01
IGL03390:Kcns3 APN 12 11091232 missense probably benign
R0583:Kcns3 UTSW 12 11091478 missense probably damaging 1.00
R0629:Kcns3 UTSW 12 11092558 missense probably damaging 1.00
R1549:Kcns3 UTSW 12 11092083 missense probably damaging 1.00
R1755:Kcns3 UTSW 12 11091444 missense probably benign 0.09
R2507:Kcns3 UTSW 12 11092086 missense possibly damaging 0.67
R4348:Kcns3 UTSW 12 11091381 missense possibly damaging 0.85
R4667:Kcns3 UTSW 12 11091783 missense probably damaging 1.00
R4750:Kcns3 UTSW 12 11091654 missense probably damaging 1.00
R5704:Kcns3 UTSW 12 11092327 missense probably benign 0.05
R5770:Kcns3 UTSW 12 11092249 missense probably benign 0.15
R6882:Kcns3 UTSW 12 11092048 missense probably benign 0.00
R7014:Kcns3 UTSW 12 11091687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCACGATGCCAATGGAAGAC -3'
(R):5'- AGTTACCATGAGGTGGGGCTACTG -3'

Sequencing Primer
(F):5'- ACGTCCCTAATGTTAAAGTACGG -3'
(R):5'- GTGGGGCTACTGCTTCTC -3'
Posted On2014-05-09