Incidental Mutation 'R1571:Tjp2'
ID186240
Institutional Source Beutler Lab
Gene Symbol Tjp2
Ensembl Gene ENSMUSG00000024812
Gene Nametight junction protein 2
SynonymsZO-2
MMRRC Submission 039610-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1571 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location24094523-24225026 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24100875 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 885 (Y885H)
Ref Sequence ENSEMBL: ENSMUSP00000097154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099558]
PDB Structure
Solution structure of N-terminal PDZ domain from mouse TJP2 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000099558
AA Change: Y885H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097154
Gene: ENSMUSG00000024812
AA Change: Y885H

DomainStartEndE-ValueType
PDZ 19 97 1.25e-15 SMART
low complexity region 163 178 N/A INTRINSIC
low complexity region 181 202 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 253 276 N/A INTRINSIC
PDZ 297 365 8.73e-15 SMART
low complexity region 377 390 N/A INTRINSIC
PDZ 499 572 1.57e-16 SMART
SH3 587 648 1.07e-2 SMART
GuKc 672 861 3.25e-42 SMART
low complexity region 969 980 N/A INTRINSIC
low complexity region 1037 1049 N/A INTRINSIC
coiled coil region 1063 1090 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zonula occluden that is a member of the membrane-associated guanylate kinase homolog family. The encoded protein functions as a component of the tight junction barrier in epithelial and endothelial cells and is necessary for proper assembly of tight junctions. Mutations in this gene have been identified in patients with hypercholanemia, and genomic duplication of a 270 kb region including this gene causes autosomal dominant deafness-51. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in lethality shortly after implantation due to arrest in early gastrulation. Structure and permeability barrier of the apical junctional complex are altered in cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610524H06Rik A G 5: 114,823,311 probably null Het
Abcd3 T C 3: 121,792,842 I70V possibly damaging Het
Acad10 T C 5: 121,621,348 Y1024C probably damaging Het
Atp2b3 T G X: 73,545,106 V701G probably damaging Het
Cbfa2t2 T A 2: 154,500,427 M21K probably damaging Het
Cdc25a C T 9: 109,881,546 T106I possibly damaging Het
Cdhr5 T C 7: 141,272,170 T190A probably damaging Het
Chl1 A G 6: 103,708,484 T829A probably benign Het
Clcn6 T C 4: 148,012,769 T614A possibly damaging Het
Cntln A T 4: 84,947,586 R160* probably null Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dock3 C A 9: 106,937,959 M1236I possibly damaging Het
Eif4g3 T A 4: 138,120,408 H213Q probably damaging Het
Eya1 T A 1: 14,208,917 H372L probably damaging Het
Fam13b A G 18: 34,497,432 V91A possibly damaging Het
Gm5724 A T 6: 141,754,409 C132* probably null Het
Hat1 T A 2: 71,434,175 I319K probably benign Het
Kcnf1 T C 12: 17,175,852 N123D probably benign Het
Kcns3 C A 12: 11,091,550 G383W probably damaging Het
Kprp A T 3: 92,825,382 C120* probably null Het
Lama3 T A 18: 12,539,717 C2456S probably damaging Het
Lrp1b A T 2: 41,476,646 D539E probably damaging Het
Matn3 T C 12: 8,955,466 L292S probably damaging Het
Mbd3l1 T A 9: 18,484,651 I24N probably damaging Het
Med10 T C 13: 69,810,040 L37P probably damaging Het
Mrc1 A T 2: 14,308,733 H925L probably damaging Het
Myo15 T A 11: 60,518,464 I3219N probably damaging Het
Nom1 C T 5: 29,442,635 Q623* probably null Het
Nrm T A 17: 35,864,187 W136R probably damaging Het
Olfr1098 A C 2: 86,923,445 V29G probably benign Het
Pde7b T C 10: 20,413,090 N298S probably benign Het
Piezo2 C T 18: 63,144,919 A305T possibly damaging Het
Pimreg T C 11: 72,045,216 L175P possibly damaging Het
Pkhd1l1 A G 15: 44,526,841 D1451G probably benign Het
Ptpro A G 6: 137,378,130 S212G probably benign Het
Rhpn1 C T 15: 75,714,118 R627C possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnase4 T G 14: 51,105,040 F74V probably damaging Het
Sbno2 A G 10: 80,060,392 probably null Het
Selp T C 1: 164,126,607 Y159H probably damaging Het
Senp6 A G 9: 80,093,571 T21A probably damaging Het
Slco3a1 T C 7: 74,504,380 D148G possibly damaging Het
Smtn G A 11: 3,530,102 P373L probably benign Het
Snx20 A T 8: 88,629,969 L73Q probably damaging Het
Sobp A G 10: 43,157,946 V128A possibly damaging Het
Tcerg1 A G 18: 42,524,292 T280A unknown Het
Tgfbrap1 A G 1: 43,049,813 V810A probably benign Het
Thbs1 C A 2: 118,119,197 D589E probably damaging Het
Tmem109 A G 19: 10,872,629 S100P probably damaging Het
Trim36 T C 18: 46,172,495 K462E probably benign Het
Vmn1r226 A T 17: 20,688,276 I257F probably damaging Het
Vmn2r92 A G 17: 18,152,090 Y54C probably damaging Het
Wdcp T A 12: 4,851,924 Y593* probably null Het
Wdr59 T C 8: 111,451,050 S907G probably damaging Het
Other mutations in Tjp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Tjp2 APN 19 24138810 missense possibly damaging 0.89
IGL01412:Tjp2 APN 19 24100775 missense probably damaging 0.99
IGL01681:Tjp2 APN 19 24134849 critical splice donor site probably null
IGL02044:Tjp2 APN 19 24120840 missense probably damaging 1.00
IGL02212:Tjp2 APN 19 24138786 missense probably damaging 1.00
IGL02629:Tjp2 APN 19 24122379 splice site probably benign
IGL02819:Tjp2 APN 19 24114105 missense probably damaging 0.98
IGL02931:Tjp2 APN 19 24096632 missense probably benign 0.11
R0032:Tjp2 UTSW 19 24108695 missense probably damaging 1.00
R0667:Tjp2 UTSW 19 24108749 missense probably benign 0.36
R0674:Tjp2 UTSW 19 24131316 missense probably benign 0.37
R0749:Tjp2 UTSW 19 24122272 missense possibly damaging 0.67
R1185:Tjp2 UTSW 19 24131163 missense possibly damaging 0.67
R1185:Tjp2 UTSW 19 24131163 missense possibly damaging 0.67
R1185:Tjp2 UTSW 19 24131163 missense possibly damaging 0.67
R1563:Tjp2 UTSW 19 24132703 missense probably damaging 0.99
R1624:Tjp2 UTSW 19 24131412 missense probably benign 0.01
R1658:Tjp2 UTSW 19 24112947 missense probably damaging 0.99
R1851:Tjp2 UTSW 19 24099535 missense possibly damaging 0.67
R1968:Tjp2 UTSW 19 24111073 missense probably damaging 0.99
R2068:Tjp2 UTSW 19 24122323 missense probably benign 0.22
R2273:Tjp2 UTSW 19 24112807 missense probably benign
R2994:Tjp2 UTSW 19 24112851 missense probably damaging 1.00
R3767:Tjp2 UTSW 19 24100826 missense probably benign 0.01
R3770:Tjp2 UTSW 19 24100826 missense probably benign 0.01
R4077:Tjp2 UTSW 19 24108818 missense possibly damaging 0.90
R4079:Tjp2 UTSW 19 24108818 missense possibly damaging 0.90
R4505:Tjp2 UTSW 19 24108831 missense possibly damaging 0.50
R4720:Tjp2 UTSW 19 24100805 missense probably damaging 1.00
R4739:Tjp2 UTSW 19 24120111 intron probably null
R4745:Tjp2 UTSW 19 24096666 missense possibly damaging 0.56
R4858:Tjp2 UTSW 19 24122120 missense probably damaging 1.00
R5290:Tjp2 UTSW 19 24131204 missense probably benign
R5887:Tjp2 UTSW 19 24096599 missense probably benign
R5988:Tjp2 UTSW 19 24114100 missense probably benign
R6144:Tjp2 UTSW 19 24120073 missense probably damaging 0.99
R6163:Tjp2 UTSW 19 24125704 critical splice donor site probably null
R6183:Tjp2 UTSW 19 24100791 missense probably damaging 0.99
R6242:Tjp2 UTSW 19 24099603 intron probably null
R6683:Tjp2 UTSW 19 24120843 missense probably damaging 0.99
R6866:Tjp2 UTSW 19 24101991 missense probably damaging 0.99
R7025:Tjp2 UTSW 19 24132688 missense probably benign 0.28
R7153:Tjp2 UTSW 19 24101981 missense not run
X0066:Tjp2 UTSW 19 24098027 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGGATACTTTCCACAGCGCCC -3'
(R):5'- TCAGTTCAAAGCCAAGTGACAGCAG -3'

Sequencing Primer
(F):5'- AAGCTGCCCAAGGGTGTG -3'
(R):5'- CCAAGTGACAGCAGGGAGC -3'
Posted On2014-05-09