Incidental Mutation 'R1571:Atp2b3'
ID186241
Institutional Source Beutler Lab
Gene Symbol Atp2b3
Ensembl Gene ENSMUSG00000031376
Gene NameATPase, Ca++ transporting, plasma membrane 3
SynonymsPmca3, 6430519O13Rik
MMRRC Submission 039610-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R1571 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location73503086-73571005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 73545106 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 701 (V701G)
Ref Sequence ENSEMBL: ENSMUSP00000110123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033744] [ENSMUST00000088429] [ENSMUST00000114479]
Predicted Effect probably damaging
Transcript: ENSMUST00000033744
AA Change: V701G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033744
Gene: ENSMUSG00000031376
AA Change: V701G

DomainStartEndE-ValueType
Cation_ATPase_N 50 126 1.39e-4 SMART
Pfam:E1-E2_ATPase 159 463 3.3e-58 PFAM
Pfam:Hydrolase 467 806 2.1e-27 PFAM
Pfam:HAD 470 803 2.4e-17 PFAM
Pfam:Hydrolase_like2 516 612 2.4e-17 PFAM
Pfam:Hydrolase_3 764 839 7.4e-7 PFAM
transmembrane domain 852 874 N/A INTRINSIC
Pfam:Cation_ATPase_C 876 1058 2.4e-47 PFAM
low complexity region 1076 1096 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1100 1115 1.7e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000088429
AA Change: V701G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085775
Gene: ENSMUSG00000031376
AA Change: V701G

DomainStartEndE-ValueType
Cation_ATPase_N 50 126 1.39e-4 SMART
Pfam:E1-E2_ATPase 158 310 1.8e-29 PFAM
Pfam:E1-E2_ATPase 348 462 3e-13 PFAM
Pfam:Hydrolase 467 806 1.3e-16 PFAM
Pfam:HAD 470 803 3.8e-21 PFAM
Pfam:Cation_ATPase 516 612 7.9e-18 PFAM
Pfam:Hydrolase_3 764 839 5.4e-7 PFAM
transmembrane domain 852 874 N/A INTRINSIC
Pfam:Cation_ATPase_C 876 1058 1.5e-48 PFAM
low complexity region 1076 1096 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1100 1152 4.1e-27 PFAM
low complexity region 1174 1184 N/A INTRINSIC
low complexity region 1193 1207 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114479
AA Change: V701G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110123
Gene: ENSMUSG00000031376
AA Change: V701G

DomainStartEndE-ValueType
Cation_ATPase_N 50 126 1.39e-4 SMART
Pfam:E1-E2_ATPase 159 463 4.1e-58 PFAM
Pfam:Hydrolase 467 806 4.9e-27 PFAM
Pfam:HAD 470 803 4.7e-17 PFAM
Pfam:Hydrolase_like2 516 612 1.8e-17 PFAM
Pfam:Hydrolase_3 764 839 2.1e-6 PFAM
transmembrane domain 852 874 N/A INTRINSIC
Pfam:Cation_ATPase_C 876 1058 2.3e-47 PFAM
low complexity region 1076 1096 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1100 1163 2.4e-15 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 3. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610524H06Rik A G 5: 114,823,311 probably null Het
Abcd3 T C 3: 121,792,842 I70V possibly damaging Het
Acad10 T C 5: 121,621,348 Y1024C probably damaging Het
Cbfa2t2 T A 2: 154,500,427 M21K probably damaging Het
Cdc25a C T 9: 109,881,546 T106I possibly damaging Het
Cdhr5 T C 7: 141,272,170 T190A probably damaging Het
Chl1 A G 6: 103,708,484 T829A probably benign Het
Clcn6 T C 4: 148,012,769 T614A possibly damaging Het
Cntln A T 4: 84,947,586 R160* probably null Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dock3 C A 9: 106,937,959 M1236I possibly damaging Het
Eif4g3 T A 4: 138,120,408 H213Q probably damaging Het
Eya1 T A 1: 14,208,917 H372L probably damaging Het
Fam13b A G 18: 34,497,432 V91A possibly damaging Het
Gm5724 A T 6: 141,754,409 C132* probably null Het
Hat1 T A 2: 71,434,175 I319K probably benign Het
Kcnf1 T C 12: 17,175,852 N123D probably benign Het
Kcns3 C A 12: 11,091,550 G383W probably damaging Het
Kprp A T 3: 92,825,382 C120* probably null Het
Lama3 T A 18: 12,539,717 C2456S probably damaging Het
Lrp1b A T 2: 41,476,646 D539E probably damaging Het
Matn3 T C 12: 8,955,466 L292S probably damaging Het
Mbd3l1 T A 9: 18,484,651 I24N probably damaging Het
Med10 T C 13: 69,810,040 L37P probably damaging Het
Mrc1 A T 2: 14,308,733 H925L probably damaging Het
Myo15 T A 11: 60,518,464 I3219N probably damaging Het
Nom1 C T 5: 29,442,635 Q623* probably null Het
Nrm T A 17: 35,864,187 W136R probably damaging Het
Olfr1098 A C 2: 86,923,445 V29G probably benign Het
Pde7b T C 10: 20,413,090 N298S probably benign Het
Piezo2 C T 18: 63,144,919 A305T possibly damaging Het
Pimreg T C 11: 72,045,216 L175P possibly damaging Het
Pkhd1l1 A G 15: 44,526,841 D1451G probably benign Het
Ptpro A G 6: 137,378,130 S212G probably benign Het
Rhpn1 C T 15: 75,714,118 R627C possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnase4 T G 14: 51,105,040 F74V probably damaging Het
Sbno2 A G 10: 80,060,392 probably null Het
Selp T C 1: 164,126,607 Y159H probably damaging Het
Senp6 A G 9: 80,093,571 T21A probably damaging Het
Slco3a1 T C 7: 74,504,380 D148G possibly damaging Het
Smtn G A 11: 3,530,102 P373L probably benign Het
Snx20 A T 8: 88,629,969 L73Q probably damaging Het
Sobp A G 10: 43,157,946 V128A possibly damaging Het
Tcerg1 A G 18: 42,524,292 T280A unknown Het
Tgfbrap1 A G 1: 43,049,813 V810A probably benign Het
Thbs1 C A 2: 118,119,197 D589E probably damaging Het
Tjp2 A G 19: 24,100,875 Y885H probably damaging Het
Tmem109 A G 19: 10,872,629 S100P probably damaging Het
Trim36 T C 18: 46,172,495 K462E probably benign Het
Vmn1r226 A T 17: 20,688,276 I257F probably damaging Het
Vmn2r92 A G 17: 18,152,090 Y54C probably damaging Het
Wdcp T A 12: 4,851,924 Y593* probably null Het
Wdr59 T C 8: 111,451,050 S907G probably damaging Het
Other mutations in Atp2b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01657:Atp2b3 APN X 73545360 splice site probably benign
IGL02640:Atp2b3 APN X 73542205 missense probably benign
R1518:Atp2b3 UTSW X 73545123 small deletion probably benign
R2920:Atp2b3 UTSW X 73533920 missense probably benign 0.21
R4214:Atp2b3 UTSW X 73570315 missense probably benign 0.00
X0004:Atp2b3 UTSW X 73535494 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTGAACTGGAACCATAGGGTTCAC -3'
(R):5'- TGCAGGGATGCCAGATATAGCCAC -3'

Sequencing Primer
(F):5'- GAACCATAGGGTTCACTGTACTG -3'
(R):5'- GCCAGATATAGCCACATGTTG -3'
Posted On2014-05-09