Incidental Mutation 'R1376:Sf3b1'
ID186242
Institutional Source Beutler Lab
Gene Symbol Sf3b1
Ensembl Gene ENSMUSG00000025982
Gene Namesplicing factor 3b, subunit 1
SynonymsTarg4, SAP155, Prp10, 2810001M05Rik, SF3b155
MMRRC Submission 039440-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1376 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location54985169-55027481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55019265 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 55 (V55E)
Ref Sequence ENSEMBL: ENSMUSP00000139469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027127] [ENSMUST00000191303]
Predicted Effect probably benign
Transcript: ENSMUST00000027127
AA Change: V55E

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027127
Gene: ENSMUSG00000025982
AA Change: V55E

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 65 75 N/A INTRINSIC
internal_repeat_1 185 276 1.77e-12 PROSPERO
Pfam:SF3b1 329 452 1.2e-51 PFAM
SCOP:d1qbkb_ 489 1289 5e-62 SMART
Blast:ARM 593 637 6e-13 BLAST
Blast:ARM 1005 1044 7e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189051
Predicted Effect probably damaging
Transcript: ENSMUST00000191303
AA Change: V55E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139469
Gene: ENSMUSG00000025982
AA Change: V55E

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 65 75 N/A INTRINSIC
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 89.2%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 1 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. The carboxy-terminal two-thirds of subunit 1 have 22 non-identical, tandem HEAT repeats that form rod-like, helical structures. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die around the 16- to 32-cell stage. Heterozygous mice exhibit various skeletal transformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,363,909 I362N possibly damaging Het
9130023H24Rik A G 7: 128,237,010 V137A probably benign Het
Adal A G 2: 121,152,530 D177G probably damaging Het
AF529169 T C 9: 89,591,246 T871A probably damaging Het
Cdcp2 G T 4: 107,102,759 V124F possibly damaging Het
Ceacam3 T C 7: 17,163,163 C685R probably damaging Het
Cep295 T C 9: 15,340,868 probably benign Het
Cfd T C 10: 79,892,152 I174T possibly damaging Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Ehd1 C T 19: 6,294,388 T226M probably damaging Het
Elp5 A G 11: 69,975,090 V120A probably benign Het
Fam208a A G 14: 27,429,381 K105E probably benign Het
Fzd1 G A 5: 4,757,174 T136M possibly damaging Het
Galntl5 G T 5: 25,186,288 V62F probably benign Het
Gm11787 A G 4: 3,516,373 noncoding transcript Het
Josd2 C A 7: 44,471,115 P50H probably damaging Het
Lect2 T A 13: 56,542,764 I133F probably damaging Het
Lifr A G 15: 7,184,764 T700A probably benign Het
Lpl T C 8: 68,887,598 W82R probably damaging Het
Man2a1 C T 17: 64,672,043 R523C possibly damaging Het
Mast4 T C 13: 102,736,408 K1959E possibly damaging Het
Olfr1122 A G 2: 87,387,818 M38V probably benign Het
Olfr1124 C T 2: 87,434,559 S24L possibly damaging Het
Pde4dip A G 3: 97,743,217 V963A probably damaging Het
Pdgfd A G 9: 6,376,994 I357V probably benign Het
Pold1 T C 7: 44,540,562 D400G probably damaging Het
Ppp1r12a T C 10: 108,198,918 I108T probably damaging Het
Rimbp2 G C 5: 128,770,291 P931A possibly damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Homo
Sec24a A C 11: 51,700,913 probably benign Het
Sult2a2 T C 7: 13,734,771 V54A probably damaging Het
Taok3 T C 5: 117,265,961 Y734H probably damaging Het
Tuba3b A G 6: 145,618,774 E90G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Other mutations in Sf3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Sf3b1 APN 1 54987486 missense probably damaging 1.00
IGL00815:Sf3b1 APN 1 54996931 splice site probably benign
IGL01380:Sf3b1 APN 1 54987949 missense probably damaging 1.00
IGL01390:Sf3b1 APN 1 54987429 missense probably benign 0.17
IGL02974:Sf3b1 APN 1 55007707 missense probably benign 0.00
IGL03159:Sf3b1 APN 1 55012213 missense probably benign
R0053:Sf3b1 UTSW 1 55000373 nonsense probably null
R0053:Sf3b1 UTSW 1 55000373 nonsense probably null
R0190:Sf3b1 UTSW 1 54990306 missense probably damaging 0.99
R0277:Sf3b1 UTSW 1 55019257 missense probably damaging 0.99
R0323:Sf3b1 UTSW 1 55019257 missense probably damaging 0.99
R0369:Sf3b1 UTSW 1 54998108 missense probably benign 0.10
R0396:Sf3b1 UTSW 1 55019271 missense probably damaging 1.00
R0718:Sf3b1 UTSW 1 55019385 missense probably damaging 0.99
R0991:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1082:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1083:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1084:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1196:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1376:Sf3b1 UTSW 1 55019265 missense probably damaging 0.99
R1381:Sf3b1 UTSW 1 55003154 missense probably damaging 0.99
R1436:Sf3b1 UTSW 1 55001421 missense possibly damaging 0.72
R1559:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1560:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1561:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1567:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1568:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1588:Sf3b1 UTSW 1 54997177 missense probably benign 0.05
R1625:Sf3b1 UTSW 1 55019377 missense probably damaging 1.00
R1694:Sf3b1 UTSW 1 55019395 missense possibly damaging 0.89
R1735:Sf3b1 UTSW 1 55000652 missense probably damaging 1.00
R1900:Sf3b1 UTSW 1 54998188 missense possibly damaging 0.75
R2186:Sf3b1 UTSW 1 55007633 missense probably benign
R2429:Sf3b1 UTSW 1 55016801 missense possibly damaging 0.71
R2473:Sf3b1 UTSW 1 54999626 critical splice donor site probably null
R3772:Sf3b1 UTSW 1 54999991 intron probably benign
R3911:Sf3b1 UTSW 1 55019389 nonsense probably null
R3970:Sf3b1 UTSW 1 55012182 nonsense probably null
R4706:Sf3b1 UTSW 1 54990507 missense probably damaging 1.00
R4707:Sf3b1 UTSW 1 54990507 missense probably damaging 1.00
R4964:Sf3b1 UTSW 1 54999712 missense probably benign
R5053:Sf3b1 UTSW 1 54997177 missense probably benign 0.05
R5358:Sf3b1 UTSW 1 55003310 missense probably benign 0.09
R5379:Sf3b1 UTSW 1 55003150 missense possibly damaging 0.94
R5628:Sf3b1 UTSW 1 54998175 missense probably benign 0.27
R5636:Sf3b1 UTSW 1 54997193 missense probably damaging 1.00
R6013:Sf3b1 UTSW 1 55000298 missense probably damaging 0.98
R6149:Sf3b1 UTSW 1 55007507 missense probably damaging 1.00
R6217:Sf3b1 UTSW 1 55007518 missense probably damaging 1.00
R6426:Sf3b1 UTSW 1 54999655 missense probably benign 0.01
R6531:Sf3b1 UTSW 1 55019395 missense probably damaging 0.99
R6945:Sf3b1 UTSW 1 54997156 missense probably benign 0.45
R7001:Sf3b1 UTSW 1 55001046 missense probably damaging 0.96
R7001:Sf3b1 UTSW 1 55014481 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCCAGTGAGGACCCTAGTATTAAGC -3'
(R):5'- TCCTTTCACCTGATGAGGTCAGGAG -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- GAGGTCAGGAGATACATGTGTAGATG -3'
Posted On2014-05-09