Incidental Mutation 'R1376:Adal'
ID186245
Institutional Source Beutler Lab
Gene Symbol Adal
Ensembl Gene ENSMUSG00000027259
Gene Nameadenosine deaminase-like
Synonyms4930578F03Rik
MMRRC Submission 039440-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R1376 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location121140428-121156680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121152530 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 177 (D177G)
Ref Sequence ENSEMBL: ENSMUSP00000028702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028702] [ENSMUST00000066155] [ENSMUST00000110662] [ENSMUST00000110665] [ENSMUST00000119031]
Predicted Effect probably damaging
Transcript: ENSMUST00000028702
AA Change: D177G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028702
Gene: ENSMUSG00000027259
AA Change: D177G

DomainStartEndE-ValueType
Pfam:A_deaminase 1 276 1.8e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066155
AA Change: D244G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000067133
Gene: ENSMUSG00000027259
AA Change: D244G

DomainStartEndE-ValueType
Pfam:A_deaminase 16 343 1.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110662
AA Change: D101G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000106290
Gene: ENSMUSG00000027259
AA Change: D101G

DomainStartEndE-ValueType
Pfam:A_deaminase 2 200 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110665
AA Change: D101G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000106293
Gene: ENSMUSG00000027259
AA Change: D101G

DomainStartEndE-ValueType
Pfam:A_deaminase 2 236 4.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119031
AA Change: D244G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000113052
Gene: ENSMUSG00000027259
AA Change: D244G

DomainStartEndE-ValueType
Pfam:A_deaminase 16 343 3e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156132
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 89.2%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,363,909 I362N possibly damaging Het
9130023H24Rik A G 7: 128,237,010 V137A probably benign Het
AF529169 T C 9: 89,591,246 T871A probably damaging Het
Cdcp2 G T 4: 107,102,759 V124F possibly damaging Het
Ceacam3 T C 7: 17,163,163 C685R probably damaging Het
Cep295 T C 9: 15,340,868 probably benign Het
Cfd T C 10: 79,892,152 I174T possibly damaging Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Ehd1 C T 19: 6,294,388 T226M probably damaging Het
Elp5 A G 11: 69,975,090 V120A probably benign Het
Fam208a A G 14: 27,429,381 K105E probably benign Het
Fzd1 G A 5: 4,757,174 T136M possibly damaging Het
Galntl5 G T 5: 25,186,288 V62F probably benign Het
Gm11787 A G 4: 3,516,373 noncoding transcript Het
Josd2 C A 7: 44,471,115 P50H probably damaging Het
Lect2 T A 13: 56,542,764 I133F probably damaging Het
Lifr A G 15: 7,184,764 T700A probably benign Het
Lpl T C 8: 68,887,598 W82R probably damaging Het
Man2a1 C T 17: 64,672,043 R523C possibly damaging Het
Mast4 T C 13: 102,736,408 K1959E possibly damaging Het
Olfr1122 A G 2: 87,387,818 M38V probably benign Het
Olfr1124 C T 2: 87,434,559 S24L possibly damaging Het
Pde4dip A G 3: 97,743,217 V963A probably damaging Het
Pdgfd A G 9: 6,376,994 I357V probably benign Het
Pold1 T C 7: 44,540,562 D400G probably damaging Het
Ppp1r12a T C 10: 108,198,918 I108T probably damaging Het
Rimbp2 G C 5: 128,770,291 P931A possibly damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Homo
Sec24a A C 11: 51,700,913 probably benign Het
Sf3b1 A T 1: 55,019,265 V55E probably damaging Het
Sult2a2 T C 7: 13,734,771 V54A probably damaging Het
Taok3 T C 5: 117,265,961 Y734H probably damaging Het
Tuba3b A G 6: 145,618,774 E90G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Other mutations in Adal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Adal APN 2 121151218 splice site probably benign
IGL01917:Adal APN 2 121142554 missense possibly damaging 0.88
IGL02487:Adal APN 2 121155396 missense probably benign 0.12
R0004:Adal UTSW 2 121152485 missense probably damaging 1.00
R0234:Adal UTSW 2 121148317 missense probably benign 0.01
R0234:Adal UTSW 2 121148317 missense probably benign 0.01
R1376:Adal UTSW 2 121152530 missense probably damaging 1.00
R4989:Adal UTSW 2 121155549 utr 3 prime probably benign
R6532:Adal UTSW 2 121146123 unclassified probably null
R6606:Adal UTSW 2 121150288 missense probably damaging 1.00
R6750:Adal UTSW 2 121142649 missense probably damaging 1.00
R6819:Adal UTSW 2 121148313 missense probably damaging 0.99
R7035:Adal UTSW 2 121155461 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTGGTTACCAGCAGAGGCCAC -3'
(R):5'- CAGTCAGTACGATGAACACAGGGAC -3'

Sequencing Primer
(F):5'- AGCAGAGGCCACTGATCC -3'
(R):5'- gaaaaagagagagggagaaaaagag -3'
Posted On2014-05-09