Incidental Mutation 'R1376:Fzd1'
ID186249
Institutional Source Beutler Lab
Gene Symbol Fzd1
Ensembl Gene ENSMUSG00000044674
Gene Namefrizzled class receptor 1
SynonymsFZ-1, Fz1
MMRRC Submission 039440-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1376 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location4753839-4758035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4757174 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 136 (T136M)
Ref Sequence ENSEMBL: ENSMUSP00000058629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054294]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054294
AA Change: T136M

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058629
Gene: ENSMUSG00000044674
AA Change: T136M

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 71 96 N/A INTRINSIC
FRI 110 227 7.77e-72 SMART
low complexity region 249 262 N/A INTRINSIC
Frizzled 304 635 4.18e-224 SMART
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 89.2%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the 'frizzled' gene family encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The FZD1 protein contains a signal peptide, a cysteine-rich domain in the N-terminal extracellular region, 7 transmembrane domains, and a C-terminal PDZ domain-binding motif. The FZD1 transcript is expressed in various tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,363,909 I362N possibly damaging Het
9130023H24Rik A G 7: 128,237,010 V137A probably benign Het
Adal A G 2: 121,152,530 D177G probably damaging Het
AF529169 T C 9: 89,591,246 T871A probably damaging Het
Cdcp2 G T 4: 107,102,759 V124F possibly damaging Het
Ceacam3 T C 7: 17,163,163 C685R probably damaging Het
Cep295 T C 9: 15,340,868 probably benign Het
Cfd T C 10: 79,892,152 I174T possibly damaging Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Ehd1 C T 19: 6,294,388 T226M probably damaging Het
Elp5 A G 11: 69,975,090 V120A probably benign Het
Fam208a A G 14: 27,429,381 K105E probably benign Het
Galntl5 G T 5: 25,186,288 V62F probably benign Het
Gm11787 A G 4: 3,516,373 noncoding transcript Het
Josd2 C A 7: 44,471,115 P50H probably damaging Het
Lect2 T A 13: 56,542,764 I133F probably damaging Het
Lifr A G 15: 7,184,764 T700A probably benign Het
Lpl T C 8: 68,887,598 W82R probably damaging Het
Man2a1 C T 17: 64,672,043 R523C possibly damaging Het
Mast4 T C 13: 102,736,408 K1959E possibly damaging Het
Olfr1122 A G 2: 87,387,818 M38V probably benign Het
Olfr1124 C T 2: 87,434,559 S24L possibly damaging Het
Pde4dip A G 3: 97,743,217 V963A probably damaging Het
Pdgfd A G 9: 6,376,994 I357V probably benign Het
Pold1 T C 7: 44,540,562 D400G probably damaging Het
Ppp1r12a T C 10: 108,198,918 I108T probably damaging Het
Rimbp2 G C 5: 128,770,291 P931A possibly damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Homo
Sec24a A C 11: 51,700,913 probably benign Het
Sf3b1 A T 1: 55,019,265 V55E probably damaging Het
Sult2a2 T C 7: 13,734,771 V54A probably damaging Het
Taok3 T C 5: 117,265,961 Y734H probably damaging Het
Tuba3b A G 6: 145,618,774 E90G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Other mutations in Fzd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01560:Fzd1 APN 5 4756037 missense probably benign 0.11
R0055:Fzd1 UTSW 5 4756037 missense possibly damaging 0.86
R0055:Fzd1 UTSW 5 4756037 missense possibly damaging 0.86
R0402:Fzd1 UTSW 5 4755702 missense possibly damaging 0.46
R1376:Fzd1 UTSW 5 4757174 missense possibly damaging 0.84
R1585:Fzd1 UTSW 5 4756278 missense probably damaging 1.00
R1606:Fzd1 UTSW 5 4757514 nonsense probably null
R1708:Fzd1 UTSW 5 4755791 missense possibly damaging 0.82
R1767:Fzd1 UTSW 5 4756812 missense probably benign
R1803:Fzd1 UTSW 5 4756385 missense probably damaging 0.97
R1909:Fzd1 UTSW 5 4757481 missense probably benign 0.01
R2990:Fzd1 UTSW 5 4755758 missense probably damaging 0.98
R4446:Fzd1 UTSW 5 4755777 missense probably damaging 1.00
R4631:Fzd1 UTSW 5 4755865 nonsense probably null
R4632:Fzd1 UTSW 5 4755865 nonsense probably null
R4633:Fzd1 UTSW 5 4755865 nonsense probably null
R5110:Fzd1 UTSW 5 4756448 missense probably benign 0.00
R6406:Fzd1 UTSW 5 4756089 missense probably damaging 1.00
R6489:Fzd1 UTSW 5 4757336 missense probably benign 0.33
R6642:Fzd1 UTSW 5 4755696 missense probably damaging 1.00
R7095:Fzd1 UTSW 5 4755824
R7150:Fzd1 UTSW 5 4756145 missense not run
X0028:Fzd1 UTSW 5 4756958 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCGGATTACTGGTCCAGAACTC -3'
(R):5'- AACTTTGTGCCGAAGCACTCCC -3'

Sequencing Primer
(F):5'- ACTGGTCCAGAACTCTGGTAG -3'
(R):5'- AGGCTCCTCTGCTTTTGG -3'
Posted On2014-05-09