Incidental Mutation 'R1376:Tuba3b'
ID186253
Institutional Source Beutler Lab
Gene Symbol Tuba3b
Ensembl Gene ENSMUSG00000067338
Gene Nametubulin, alpha 3B
SynonymsM[a]7, Tuba7
MMRRC Submission 039440-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R1376 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location145615757-145621479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145618774 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 90 (E90G)
Ref Sequence ENSEMBL: ENSMUSP00000084713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087445] [ENSMUST00000148739]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087445
AA Change: E90G

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000084713
Gene: ENSMUSG00000067338
AA Change: E90G

DomainStartEndE-ValueType
Tubulin 49 246 4.47e-81 SMART
Tubulin_C 248 393 8.44e-59 SMART
low complexity region 433 449 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144829
Predicted Effect probably benign
Transcript: ENSMUST00000148739
SMART Domains Protein: ENSMUSP00000120740
Gene: ENSMUSG00000054966

DomainStartEndE-ValueType
Pfam:LTD 24 144 1.2e-18 PFAM
low complexity region 228 244 N/A INTRINSIC
low complexity region 248 266 N/A INTRINSIC
Meta Mutation Damage Score 0.252 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 89.2%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,363,909 I362N possibly damaging Het
9130023H24Rik A G 7: 128,237,010 V137A probably benign Het
Adal A G 2: 121,152,530 D177G probably damaging Het
AF529169 T C 9: 89,591,246 T871A probably damaging Het
Cdcp2 G T 4: 107,102,759 V124F possibly damaging Het
Ceacam3 T C 7: 17,163,163 C685R probably damaging Het
Cep295 T C 9: 15,340,868 probably benign Het
Cfd T C 10: 79,892,152 I174T possibly damaging Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Ehd1 C T 19: 6,294,388 T226M probably damaging Het
Elp5 A G 11: 69,975,090 V120A probably benign Het
Fam208a A G 14: 27,429,381 K105E probably benign Het
Fzd1 G A 5: 4,757,174 T136M possibly damaging Het
Galntl5 G T 5: 25,186,288 V62F probably benign Het
Gm11787 A G 4: 3,516,373 noncoding transcript Het
Josd2 C A 7: 44,471,115 P50H probably damaging Het
Lect2 T A 13: 56,542,764 I133F probably damaging Het
Lifr A G 15: 7,184,764 T700A probably benign Het
Lpl T C 8: 68,887,598 W82R probably damaging Het
Man2a1 C T 17: 64,672,043 R523C possibly damaging Het
Mast4 T C 13: 102,736,408 K1959E possibly damaging Het
Olfr1122 A G 2: 87,387,818 M38V probably benign Het
Olfr1124 C T 2: 87,434,559 S24L possibly damaging Het
Pde4dip A G 3: 97,743,217 V963A probably damaging Het
Pdgfd A G 9: 6,376,994 I357V probably benign Het
Pold1 T C 7: 44,540,562 D400G probably damaging Het
Ppp1r12a T C 10: 108,198,918 I108T probably damaging Het
Rimbp2 G C 5: 128,770,291 P931A possibly damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Homo
Sec24a A C 11: 51,700,913 probably benign Het
Sf3b1 A T 1: 55,019,265 V55E probably damaging Het
Sult2a2 T C 7: 13,734,771 V54A probably damaging Het
Taok3 T C 5: 117,265,961 Y734H probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Other mutations in Tuba3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02159:Tuba3b APN 6 145619666 missense probably benign 0.01
IGL03027:Tuba3b APN 6 145619391 missense probably damaging 1.00
IGL03336:Tuba3b APN 6 145619724 missense possibly damaging 0.90
R0086:Tuba3b UTSW 6 145621160 missense probably damaging 1.00
R0454:Tuba3b UTSW 6 145618269 missense probably benign 0.13
R0631:Tuba3b UTSW 6 145619576 missense probably damaging 0.99
R1376:Tuba3b UTSW 6 145618774 missense possibly damaging 0.86
R1476:Tuba3b UTSW 6 145618453 missense possibly damaging 0.61
R2137:Tuba3b UTSW 6 145618833 missense probably benign
R4993:Tuba3b UTSW 6 145621273 missense possibly damaging 0.79
R5796:Tuba3b UTSW 6 145619682 missense probably damaging 1.00
R5945:Tuba3b UTSW 6 145619745 missense probably damaging 0.99
R6045:Tuba3b UTSW 6 145621174 missense probably damaging 1.00
R6768:Tuba3b UTSW 6 145618729 splice site probably null
R7055:Tuba3b UTSW 6 145621209 missense possibly damaging 0.54
X0023:Tuba3b UTSW 6 145621174 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGGGACGACTCATTCAACACATTC -3'
(R):5'- TCAGATCGTCTACCATACAGACGCC -3'

Sequencing Primer
(F):5'- GTGTCTCGGAAAAGCCCAC -3'
(R):5'- CCGCACTGGGTTTGAATACAATG -3'
Posted On2014-05-09