Incidental Mutation 'R1376:Ceacam3'
ID186255
Institutional Source Beutler Lab
Gene Symbol Ceacam3
Ensembl Gene ENSMUSG00000053228
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 3
SynonymsEG384557, cea12, Psg24
MMRRC Submission 039440-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1376 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location17150282-17164253 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17163163 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 685 (C685R)
Ref Sequence ENSEMBL: ENSMUSP00000104131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108491]
Predicted Effect probably damaging
Transcript: ENSMUST00000108491
AA Change: C685R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104131
Gene: ENSMUSG00000053228
AA Change: C685R

DomainStartEndE-ValueType
IG 40 141 2.83e-3 SMART
IG 160 261 6.31e-1 SMART
IG 280 379 8.01e-3 SMART
IG 398 497 2.08e-1 SMART
IG 514 613 1.26e0 SMART
IGc2 631 695 7.64e-9 SMART
Meta Mutation Damage Score 0.5 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 89.2%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,363,909 I362N possibly damaging Het
9130023H24Rik A G 7: 128,237,010 V137A probably benign Het
Adal A G 2: 121,152,530 D177G probably damaging Het
AF529169 T C 9: 89,591,246 T871A probably damaging Het
Cdcp2 G T 4: 107,102,759 V124F possibly damaging Het
Cep295 T C 9: 15,340,868 probably benign Het
Cfd T C 10: 79,892,152 I174T possibly damaging Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Ehd1 C T 19: 6,294,388 T226M probably damaging Het
Elp5 A G 11: 69,975,090 V120A probably benign Het
Fam208a A G 14: 27,429,381 K105E probably benign Het
Fzd1 G A 5: 4,757,174 T136M possibly damaging Het
Galntl5 G T 5: 25,186,288 V62F probably benign Het
Gm11787 A G 4: 3,516,373 noncoding transcript Het
Josd2 C A 7: 44,471,115 P50H probably damaging Het
Lect2 T A 13: 56,542,764 I133F probably damaging Het
Lifr A G 15: 7,184,764 T700A probably benign Het
Lpl T C 8: 68,887,598 W82R probably damaging Het
Man2a1 C T 17: 64,672,043 R523C possibly damaging Het
Mast4 T C 13: 102,736,408 K1959E possibly damaging Het
Olfr1122 A G 2: 87,387,818 M38V probably benign Het
Olfr1124 C T 2: 87,434,559 S24L possibly damaging Het
Pde4dip A G 3: 97,743,217 V963A probably damaging Het
Pdgfd A G 9: 6,376,994 I357V probably benign Het
Pold1 T C 7: 44,540,562 D400G probably damaging Het
Ppp1r12a T C 10: 108,198,918 I108T probably damaging Het
Rimbp2 G C 5: 128,770,291 P931A possibly damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Homo
Sec24a A C 11: 51,700,913 probably benign Het
Sf3b1 A T 1: 55,019,265 V55E probably damaging Het
Sult2a2 T C 7: 13,734,771 V54A probably damaging Het
Taok3 T C 5: 117,265,961 Y734H probably damaging Het
Tuba3b A G 6: 145,618,774 E90G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Other mutations in Ceacam3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Ceacam3 APN 7 17151857 missense probably benign 0.03
IGL01510:Ceacam3 APN 7 17159842 missense probably benign 0.00
IGL01830:Ceacam3 APN 7 17155000 missense possibly damaging 0.79
IGL02155:Ceacam3 APN 7 17162981 missense possibly damaging 0.58
IGL02281:Ceacam3 APN 7 17161731 missense probably benign 0.43
IGL02301:Ceacam3 APN 7 17163101 missense probably damaging 1.00
IGL02320:Ceacam3 APN 7 17161940 missense probably benign 0.43
IGL02514:Ceacam3 APN 7 17162981 missense possibly damaging 0.58
IGL02929:Ceacam3 APN 7 17158190 missense probably damaging 1.00
IGL03143:Ceacam3 APN 7 17158120 nonsense probably null
IGL03269:Ceacam3 APN 7 17161842 missense probably damaging 0.99
R0408:Ceacam3 UTSW 7 17151883 critical splice donor site probably benign
R0591:Ceacam3 UTSW 7 17151883 critical splice donor site probably null
R1274:Ceacam3 UTSW 7 17163139 missense probably damaging 0.98
R1376:Ceacam3 UTSW 7 17163163 missense probably damaging 1.00
R1490:Ceacam3 UTSW 7 17163146 missense probably damaging 1.00
R1635:Ceacam3 UTSW 7 17159977 missense probably damaging 1.00
R1769:Ceacam3 UTSW 7 17158376 missense probably damaging 1.00
R2345:Ceacam3 UTSW 7 17155000 missense possibly damaging 0.79
R2367:Ceacam3 UTSW 7 17151888 splice site probably null
R2403:Ceacam3 UTSW 7 17161854 missense probably damaging 1.00
R4030:Ceacam3 UTSW 7 17158342 missense probably benign 0.43
R4240:Ceacam3 UTSW 7 17160024 missense possibly damaging 0.95
R5305:Ceacam3 UTSW 7 17151576 missense probably damaging 1.00
R5314:Ceacam3 UTSW 7 17158371 missense possibly damaging 0.94
R5433:Ceacam3 UTSW 7 17159883 missense possibly damaging 0.48
R5538:Ceacam3 UTSW 7 17158421 missense probably damaging 1.00
R5638:Ceacam3 UTSW 7 17159935 missense probably damaging 0.98
R5787:Ceacam3 UTSW 7 17155046 missense possibly damaging 0.80
R5891:Ceacam3 UTSW 7 17151793 missense probably damaging 1.00
R5918:Ceacam3 UTSW 7 17159745 missense probably damaging 0.99
R6074:Ceacam3 UTSW 7 17151559 missense probably benign 0.05
R6386:Ceacam3 UTSW 7 17158219 missense probably benign 0.22
R6439:Ceacam3 UTSW 7 17158328 missense possibly damaging 0.59
R6455:Ceacam3 UTSW 7 17161938 missense possibly damaging 0.81
R7150:Ceacam3 UTSW 7 17151562 missense not run
Predicted Primers PCR Primer
(F):5'- TCATGAGAGTCACGGACACCACAG -3'
(R):5'- ACCAAGTCTCTATGATCTGGCCTGC -3'

Sequencing Primer
(F):5'- CCACAGTCAGAGTGCAGAGC -3'
(R):5'- AGATGTGACTCACCATGCTG -3'
Posted On2014-05-09