Incidental Mutation 'R1376:Josd2'
ID186256
Institutional Source Beutler Lab
Gene Symbol Josd2
Ensembl Gene ENSMUSG00000038695
Gene NameJosephin domain containing 2
Synonyms1110007C05Rik
MMRRC Submission 039440-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R1376 (G1)
Quality Score164
Status Validated
Chromosome7
Chromosomal Location44467980-44471662 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 44471115 bp
ZygosityHeterozygous
Amino Acid Change Proline to Histidine at position 50 (P50H)
Ref Sequence ENSEMBL: ENSMUSP00000112796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035844] [ENSMUST00000035929] [ENSMUST00000117324] [ENSMUST00000118493] [ENSMUST00000118628] [ENSMUST00000120852] [ENSMUST00000121922] [ENSMUST00000134398] [ENSMUST00000135624] [ENSMUST00000136609] [ENSMUST00000136679] [ENSMUST00000146128] [ENSMUST00000152902] [ENSMUST00000156957] [ENSMUST00000206887] [ENSMUST00000208117]
Predicted Effect probably damaging
Transcript: ENSMUST00000035844
AA Change: P92H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048415
Gene: ENSMUSG00000038695
AA Change: P92H

DomainStartEndE-ValueType
Josephin 18 176 1.47e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000035929
SMART Domains Protein: ENSMUSP00000039202
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:NAD_binding_3 17 128 3.8e-24 PFAM
Pfam:DUF108 174 265 2.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117324
AA Change: P92H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113313
Gene: ENSMUSG00000038695
AA Change: P92H

DomainStartEndE-ValueType
Josephin 18 176 1.47e-81 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118493
AA Change: P92H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113226
Gene: ENSMUSG00000038695
AA Change: P92H

DomainStartEndE-ValueType
Josephin 18 176 1.47e-81 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118628
AA Change: P92H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113172
Gene: ENSMUSG00000038695
AA Change: P92H

DomainStartEndE-ValueType
Josephin 18 176 1.47e-81 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120852
AA Change: P92H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114105
Gene: ENSMUSG00000038695
AA Change: P92H

DomainStartEndE-ValueType
Josephin 18 176 1.47e-81 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121922
AA Change: P50H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112796
Gene: ENSMUSG00000038695
AA Change: P50H

DomainStartEndE-ValueType
Josephin 18 134 7e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133801
Predicted Effect probably benign
Transcript: ENSMUST00000134398
Predicted Effect probably benign
Transcript: ENSMUST00000135624
Predicted Effect probably benign
Transcript: ENSMUST00000136609
SMART Domains Protein: ENSMUSP00000123205
Gene: ENSMUSG00000038695

DomainStartEndE-ValueType
Josephin 18 97 7.71e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136679
SMART Domains Protein: ENSMUSP00000114900
Gene: ENSMUSG00000038695

DomainStartEndE-ValueType
Pfam:Josephin 18 61 3.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139097
Predicted Effect probably benign
Transcript: ENSMUST00000146128
SMART Domains Protein: ENSMUSP00000119474
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:NAD_binding_3 5 110 1e-19 PFAM
Pfam:DUF108 153 252 7.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149341
Predicted Effect probably benign
Transcript: ENSMUST00000152902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155659
Predicted Effect probably benign
Transcript: ENSMUST00000156957
SMART Domains Protein: ENSMUSP00000121766
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:DUF108 52 151 2.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206210
Predicted Effect probably benign
Transcript: ENSMUST00000206887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207591
Predicted Effect probably benign
Transcript: ENSMUST00000208117
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 89.2%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a Josephin domain. Josephin domain-containing proteins are deubiquitinating enzymes which catalyze the hydrolysis of the bond between the C-terminal glycine of the ubiquitin peptide and protein substrates. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,363,909 I362N possibly damaging Het
9130023H24Rik A G 7: 128,237,010 V137A probably benign Het
Adal A G 2: 121,152,530 D177G probably damaging Het
AF529169 T C 9: 89,591,246 T871A probably damaging Het
Cdcp2 G T 4: 107,102,759 V124F possibly damaging Het
Ceacam3 T C 7: 17,163,163 C685R probably damaging Het
Cep295 T C 9: 15,340,868 probably benign Het
Cfd T C 10: 79,892,152 I174T possibly damaging Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Ehd1 C T 19: 6,294,388 T226M probably damaging Het
Elp5 A G 11: 69,975,090 V120A probably benign Het
Fam208a A G 14: 27,429,381 K105E probably benign Het
Fzd1 G A 5: 4,757,174 T136M possibly damaging Het
Galntl5 G T 5: 25,186,288 V62F probably benign Het
Gm11787 A G 4: 3,516,373 noncoding transcript Het
Lect2 T A 13: 56,542,764 I133F probably damaging Het
Lifr A G 15: 7,184,764 T700A probably benign Het
Lpl T C 8: 68,887,598 W82R probably damaging Het
Man2a1 C T 17: 64,672,043 R523C possibly damaging Het
Mast4 T C 13: 102,736,408 K1959E possibly damaging Het
Olfr1122 A G 2: 87,387,818 M38V probably benign Het
Olfr1124 C T 2: 87,434,559 S24L possibly damaging Het
Pde4dip A G 3: 97,743,217 V963A probably damaging Het
Pdgfd A G 9: 6,376,994 I357V probably benign Het
Pold1 T C 7: 44,540,562 D400G probably damaging Het
Ppp1r12a T C 10: 108,198,918 I108T probably damaging Het
Rimbp2 G C 5: 128,770,291 P931A possibly damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Homo
Sec24a A C 11: 51,700,913 probably benign Het
Sf3b1 A T 1: 55,019,265 V55E probably damaging Het
Sult2a2 T C 7: 13,734,771 V54A probably damaging Het
Taok3 T C 5: 117,265,961 Y734H probably damaging Het
Tuba3b A G 6: 145,618,774 E90G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Other mutations in Josd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Josd2 APN 7 44471316 unclassified probably benign
IGL03029:Josd2 APN 7 44471177 missense probably damaging 0.98
R1376:Josd2 UTSW 7 44471115 missense probably damaging 1.00
R1782:Josd2 UTSW 7 44471153 missense probably damaging 1.00
R2849:Josd2 UTSW 7 44468973 splice site probably null
R4739:Josd2 UTSW 7 44471254 missense probably damaging 1.00
R4944:Josd2 UTSW 7 44471168 missense probably damaging 1.00
R6492:Josd2 UTSW 7 44471154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTTGGCCCAAGGCAGGACTAAG -3'
(R):5'- TTGGTCACCACCAATAGCACCTCG -3'

Sequencing Primer
(F):5'- tccatccccagcactcc -3'
(R):5'- TTGCAGGGCAGTTCCAG -3'
Posted On2014-05-09