Incidental Mutation 'R1376:Cfd'
ID186265
Institutional Source Beutler Lab
Gene Symbol Cfd
Ensembl Gene ENSMUSG00000061780
Gene Namecomplement factor D (adipsin)
Synonymsfactor D, D component (adipsin) of complement, Adn, DF
MMRRC Submission 039440-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R1376 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location79890853-79892655 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79892152 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 174 (I174T)
Ref Sequence ENSEMBL: ENSMUSP00000056836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046091] [ENSMUST00000061653] [ENSMUST00000105378] [ENSMUST00000165684] [ENSMUST00000217837]
Predicted Effect probably benign
Transcript: ENSMUST00000046091
SMART Domains Protein: ENSMUSP00000038925
Gene: ENSMUSG00000020125

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Tryp_SPc 28 242 3.74e-74 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000061653
AA Change: I174T

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056836
Gene: ENSMUSG00000061780
AA Change: I174T

DomainStartEndE-ValueType
Tryp_SPc 25 249 8.25e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105378
SMART Domains Protein: ENSMUSP00000101017
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
WD40 94 133 1.05e-7 SMART
Blast:WD40 143 169 4e-8 BLAST
low complexity region 206 217 N/A INTRINSIC
WD40 226 267 1.53e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165684
SMART Domains Protein: ENSMUSP00000129375
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
WD40 95 134 1.05e-7 SMART
Blast:WD40 144 170 4e-8 BLAST
low complexity region 207 218 N/A INTRINSIC
WD40 227 268 1.53e2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000217837
AA Change: I173T

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218521
Meta Mutation Damage Score 0.0944 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 89.2%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: This gene encodes a serine protease that plays an important role in the alternative pathway of complement activation for pathogen recognition and elimination. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional enzyme that in turn cleaves factor B in the complement pathway. This gene is expressed in adipocytes and the mature enzyme is secreted into the bloodstream. Mice lacking the encoded product cannot initiate alternative pathway of complement activation. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele show impaired complement activation by alternative pathway activators, and increased susceptibility to pneumococcal infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,363,909 I362N possibly damaging Het
9130023H24Rik A G 7: 128,237,010 V137A probably benign Het
Adal A G 2: 121,152,530 D177G probably damaging Het
AF529169 T C 9: 89,591,246 T871A probably damaging Het
Cdcp2 G T 4: 107,102,759 V124F possibly damaging Het
Ceacam3 T C 7: 17,163,163 C685R probably damaging Het
Cep295 T C 9: 15,340,868 probably benign Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Ehd1 C T 19: 6,294,388 T226M probably damaging Het
Elp5 A G 11: 69,975,090 V120A probably benign Het
Fam208a A G 14: 27,429,381 K105E probably benign Het
Fzd1 G A 5: 4,757,174 T136M possibly damaging Het
Galntl5 G T 5: 25,186,288 V62F probably benign Het
Gm11787 A G 4: 3,516,373 noncoding transcript Het
Josd2 C A 7: 44,471,115 P50H probably damaging Het
Lect2 T A 13: 56,542,764 I133F probably damaging Het
Lifr A G 15: 7,184,764 T700A probably benign Het
Lpl T C 8: 68,887,598 W82R probably damaging Het
Man2a1 C T 17: 64,672,043 R523C possibly damaging Het
Mast4 T C 13: 102,736,408 K1959E possibly damaging Het
Olfr1122 A G 2: 87,387,818 M38V probably benign Het
Olfr1124 C T 2: 87,434,559 S24L possibly damaging Het
Pde4dip A G 3: 97,743,217 V963A probably damaging Het
Pdgfd A G 9: 6,376,994 I357V probably benign Het
Pold1 T C 7: 44,540,562 D400G probably damaging Het
Ppp1r12a T C 10: 108,198,918 I108T probably damaging Het
Rimbp2 G C 5: 128,770,291 P931A possibly damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Homo
Sec24a A C 11: 51,700,913 probably benign Het
Sf3b1 A T 1: 55,019,265 V55E probably damaging Het
Sult2a2 T C 7: 13,734,771 V54A probably damaging Het
Taok3 T C 5: 117,265,961 Y734H probably damaging Het
Tuba3b A G 6: 145,618,774 E90G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Other mutations in Cfd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02049:Cfd APN 10 79890942 missense probably benign
R0325:Cfd UTSW 10 79891758 nonsense probably null
R1376:Cfd UTSW 10 79892152 missense possibly damaging 0.89
R1708:Cfd UTSW 10 79891607 missense probably benign 0.00
R2221:Cfd UTSW 10 79892205 unclassified probably null
R2223:Cfd UTSW 10 79892205 unclassified probably null
R4823:Cfd UTSW 10 79890948 missense probably benign
R5388:Cfd UTSW 10 79892125 missense probably damaging 1.00
R6687:Cfd UTSW 10 79891719 missense probably damaging 0.99
R6733:Cfd UTSW 10 79891802 missense probably damaging 1.00
R7085:Cfd UTSW 10 79892492 missense not run
R7123:Cfd UTSW 10 79892497 missense not run
Predicted Primers PCR Primer
(F):5'- TGTACTCAAGAGTCTAGCCTCGACC -3'
(R):5'- AAGCTCCTGAGATTCCTGAACCCC -3'

Sequencing Primer
(F):5'- GAGTCTAGCCTCGACCCTACC -3'
(R):5'- CCTTCCCACAAGCCAGG -3'
Posted On2014-05-09