Incidental Mutation 'R1376:Lect2'
ID186270
Institutional Source Beutler Lab
Gene Symbol Lect2
Ensembl Gene ENSMUSG00000021539
Gene Nameleukocyte cell-derived chemotaxin 2
Synonymschondromodulin-II
MMRRC Submission 039440-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R1376 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location56542464-56548502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56542764 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 133 (I133F)
Ref Sequence ENSEMBL: ENSMUSP00000060495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045428] [ENSMUST00000062806] [ENSMUST00000121871] [ENSMUST00000128668] [ENSMUST00000225183]
Predicted Effect probably benign
Transcript: ENSMUST00000045428
SMART Domains Protein: ENSMUSP00000035248
Gene: ENSMUSG00000035509

DomainStartEndE-ValueType
FBOX 45 85 4.77e-11 SMART
SCOP:d1a4ya_ 177 398 3e-3 SMART
Blast:LRR 203 228 2e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000062806
AA Change: I133F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060495
Gene: ENSMUSG00000021539
AA Change: I133F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Peptidase_M23 51 148 4.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121871
SMART Domains Protein: ENSMUSP00000112518
Gene: ENSMUSG00000035509

DomainStartEndE-ValueType
FBOX 71 111 4.77e-11 SMART
SCOP:d1a4ya_ 203 424 2e-3 SMART
Blast:LRR 229 254 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128668
Predicted Effect probably benign
Transcript: ENSMUST00000225183
Meta Mutation Damage Score 0.1044 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 89.2%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted, 16 kDa protein that acts as a chemotactic factor to neutrophils and stimulates the growth of chondrocytes and osteoblasts. This protein has high sequence similarity to the chondromodulin repeat regions of the chicken myb-induced myeloid 1 protein. A polymorphism in this gene may be associated with rheumatoid arthritis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display increased hepatic NKT cell numbers, increased induced cytokine secretion, and increased sensitivity to induced hepatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,363,909 I362N possibly damaging Het
9130023H24Rik A G 7: 128,237,010 V137A probably benign Het
Adal A G 2: 121,152,530 D177G probably damaging Het
AF529169 T C 9: 89,591,246 T871A probably damaging Het
Cdcp2 G T 4: 107,102,759 V124F possibly damaging Het
Ceacam3 T C 7: 17,163,163 C685R probably damaging Het
Cep295 T C 9: 15,340,868 probably benign Het
Cfd T C 10: 79,892,152 I174T possibly damaging Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Ehd1 C T 19: 6,294,388 T226M probably damaging Het
Elp5 A G 11: 69,975,090 V120A probably benign Het
Fam208a A G 14: 27,429,381 K105E probably benign Het
Fzd1 G A 5: 4,757,174 T136M possibly damaging Het
Galntl5 G T 5: 25,186,288 V62F probably benign Het
Gm11787 A G 4: 3,516,373 noncoding transcript Het
Josd2 C A 7: 44,471,115 P50H probably damaging Het
Lifr A G 15: 7,184,764 T700A probably benign Het
Lpl T C 8: 68,887,598 W82R probably damaging Het
Man2a1 C T 17: 64,672,043 R523C possibly damaging Het
Mast4 T C 13: 102,736,408 K1959E possibly damaging Het
Olfr1122 A G 2: 87,387,818 M38V probably benign Het
Olfr1124 C T 2: 87,434,559 S24L possibly damaging Het
Pde4dip A G 3: 97,743,217 V963A probably damaging Het
Pdgfd A G 9: 6,376,994 I357V probably benign Het
Pold1 T C 7: 44,540,562 D400G probably damaging Het
Ppp1r12a T C 10: 108,198,918 I108T probably damaging Het
Rimbp2 G C 5: 128,770,291 P931A possibly damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Homo
Sec24a A C 11: 51,700,913 probably benign Het
Sf3b1 A T 1: 55,019,265 V55E probably damaging Het
Sult2a2 T C 7: 13,734,771 V54A probably damaging Het
Taok3 T C 5: 117,265,961 Y734H probably damaging Het
Tuba3b A G 6: 145,618,774 E90G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Other mutations in Lect2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03036:Lect2 APN 13 56542707 makesense probably null
R1376:Lect2 UTSW 13 56542764 missense probably damaging 1.00
R4429:Lect2 UTSW 13 56545725 synonymous probably null
R5771:Lect2 UTSW 13 56548341 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- GAAGGCCCTTTAGGCTCTTTCTCAC -3'
(R):5'- TCTGACTCAAGGCTACAGAAGCCC -3'

Sequencing Primer
(F):5'- CAGGACACATGAGAGGTCATTC -3'
(R):5'- GGCTACAGAAGCCCAAATAATCTC -3'
Posted On2014-05-09