Incidental Mutation 'R1376:Lifr'
ID 186273
Institutional Source Beutler Lab
Gene Symbol Lifr
Ensembl Gene ENSMUSG00000054263
Gene Name LIF receptor alpha
Synonyms soluble differentiation-stimulating factor receptor, A230075M04Rik
MMRRC Submission 039440-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1376 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 7120095-7226970 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 7214245 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 700 (T700A)
Ref Sequence ENSEMBL: ENSMUSP00000154181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067190] [ENSMUST00000164529] [ENSMUST00000171588] [ENSMUST00000226471] [ENSMUST00000226934] [ENSMUST00000227727]
AlphaFold P42703
Predicted Effect probably benign
Transcript: ENSMUST00000067190
AA Change: T700A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000064551
Gene: ENSMUSG00000054263
AA Change: T700A

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164529
AA Change: T700A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000131434
Gene: ENSMUSG00000054263
AA Change: T700A

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 4e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171588
AA Change: T700A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000126137
Gene: ENSMUSG00000054263
AA Change: T700A

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226471
AA Change: T700A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000226934
AA Change: T700A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000227727
AA Change: T700A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 89.2%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the type I cytokine receptor family. This protein combines with a high-affinity converter subunit, gp130, to form a receptor complex that mediates the action of the leukemia inhibitory factor, a polyfunctional cytokine that is involved in cellular differentiation, proliferation and survival in the adult and the embryo. Mutations in this gene cause Schwartz-Jampel syndrome type 2, a disease belonging to the group of the bent-bone dysplasias. A translocation that involves the promoter of this gene, t(5;8)(p13;q12) with the pleiomorphic adenoma gene 1, is associated with salivary gland pleiomorphic adenoma, a common type of benign epithelial tumor of the salivary gland. Multiple splice variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die as neonates with reduced numbers of facial and spinal motor neurons, neurons of the nucleus ambiguus, and astrocytes. Mutants also show impaired placentation, severe osteopenia, and low hepatic glycogen stores. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(19)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,254,735 (GRCm39) I362N possibly damaging Het
9130023H24Rik A G 7: 127,836,182 (GRCm39) V137A probably benign Het
Adal A G 2: 120,983,011 (GRCm39) D177G probably damaging Het
Cdcp2 G T 4: 106,959,956 (GRCm39) V124F possibly damaging Het
Ceacam3 T C 7: 16,897,088 (GRCm39) C685R probably damaging Het
Cep295 T C 9: 15,252,164 (GRCm39) probably benign Het
Cfd T C 10: 79,727,986 (GRCm39) I174T possibly damaging Het
Dapk2 C G 9: 66,127,925 (GRCm39) R68G probably damaging Het
Ehd1 C T 19: 6,344,418 (GRCm39) T226M probably damaging Het
Elp5 A G 11: 69,865,916 (GRCm39) V120A probably benign Het
Fzd1 G A 5: 4,807,174 (GRCm39) T136M possibly damaging Het
Galntl5 G T 5: 25,391,286 (GRCm39) V62F probably benign Het
Gm11787 A G 4: 3,516,373 (GRCm39) noncoding transcript Het
Josd2 C A 7: 44,120,539 (GRCm39) P50H probably damaging Het
Lect2 T A 13: 56,690,577 (GRCm39) I133F probably damaging Het
Lpl T C 8: 69,340,250 (GRCm39) W82R probably damaging Het
Man2a1 C T 17: 64,979,038 (GRCm39) R523C possibly damaging Het
Mast4 T C 13: 102,872,916 (GRCm39) K1959E possibly damaging Het
Minar1 T C 9: 89,473,299 (GRCm39) T871A probably damaging Het
Or10ag57 A G 2: 87,218,162 (GRCm39) M38V probably benign Het
Or10ag58 C T 2: 87,264,903 (GRCm39) S24L possibly damaging Het
Pde4dip A G 3: 97,650,533 (GRCm39) V963A probably damaging Het
Pdgfd A G 9: 6,376,994 (GRCm39) I357V probably benign Het
Pold1 T C 7: 44,189,986 (GRCm39) D400G probably damaging Het
Ppp1r12a T C 10: 108,034,779 (GRCm39) I108T probably damaging Het
Rimbp2 G C 5: 128,847,355 (GRCm39) P931A possibly damaging Het
Rsf1 GCG GCGACG 7: 97,229,114 (GRCm39) probably benign Homo
Sec24a A C 11: 51,591,740 (GRCm39) probably benign Het
Sf3b1 A T 1: 55,058,424 (GRCm39) V55E probably damaging Het
Sult2a2 T C 7: 13,468,696 (GRCm39) V54A probably damaging Het
Taok3 T C 5: 117,404,026 (GRCm39) Y734H probably damaging Het
Tasor A G 14: 27,151,338 (GRCm39) K105E probably benign Het
Tuba3b A G 6: 145,564,500 (GRCm39) E90G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,578,962 (GRCm39) probably benign Het
Other mutations in Lifr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Lifr APN 15 7,215,220 (GRCm39) splice site probably null
IGL01470:Lifr APN 15 7,205,147 (GRCm39) nonsense probably null
IGL01489:Lifr APN 15 7,205,037 (GRCm39) splice site probably benign
IGL01619:Lifr APN 15 7,220,643 (GRCm39) missense probably damaging 1.00
IGL01636:Lifr APN 15 7,208,499 (GRCm39) splice site probably benign
IGL01943:Lifr APN 15 7,217,630 (GRCm39) missense probably damaging 1.00
IGL02253:Lifr APN 15 7,220,085 (GRCm39) missense probably damaging 1.00
IGL02355:Lifr APN 15 7,194,174 (GRCm39) critical splice donor site probably null
IGL02362:Lifr APN 15 7,194,174 (GRCm39) critical splice donor site probably null
IGL02450:Lifr APN 15 7,220,246 (GRCm39) missense probably damaging 1.00
IGL02477:Lifr APN 15 7,216,404 (GRCm39) missense probably damaging 1.00
IGL02503:Lifr APN 15 7,215,104 (GRCm39) missense probably damaging 1.00
IGL02571:Lifr APN 15 7,219,592 (GRCm39) unclassified probably benign
IGL03340:Lifr APN 15 7,207,417 (GRCm39) missense probably benign 0.02
N/A - 535:Lifr UTSW 15 7,216,434 (GRCm39) missense possibly damaging 0.80
R0012:Lifr UTSW 15 7,205,089 (GRCm39) missense possibly damaging 0.78
R0015:Lifr UTSW 15 7,217,667 (GRCm39) splice site probably null
R0102:Lifr UTSW 15 7,208,373 (GRCm39) missense probably damaging 0.98
R0102:Lifr UTSW 15 7,208,373 (GRCm39) missense probably damaging 0.98
R0305:Lifr UTSW 15 7,206,982 (GRCm39) missense probably damaging 0.99
R0416:Lifr UTSW 15 7,196,395 (GRCm39) missense probably damaging 1.00
R0440:Lifr UTSW 15 7,186,672 (GRCm39) nonsense probably null
R0519:Lifr UTSW 15 7,207,061 (GRCm39) missense probably damaging 1.00
R0595:Lifr UTSW 15 7,206,950 (GRCm39) missense probably damaging 1.00
R0601:Lifr UTSW 15 7,198,753 (GRCm39) splice site probably null
R0780:Lifr UTSW 15 7,206,947 (GRCm39) missense probably benign 0.00
R0790:Lifr UTSW 15 7,215,196 (GRCm39) missense probably benign 0.13
R1376:Lifr UTSW 15 7,214,245 (GRCm39) missense probably benign 0.04
R1400:Lifr UTSW 15 7,220,346 (GRCm39) missense probably benign 0.04
R1498:Lifr UTSW 15 7,220,099 (GRCm39) missense probably damaging 0.99
R1785:Lifr UTSW 15 7,211,337 (GRCm39) missense possibly damaging 0.89
R1786:Lifr UTSW 15 7,211,337 (GRCm39) missense possibly damaging 0.89
R1906:Lifr UTSW 15 7,217,612 (GRCm39) missense probably damaging 0.98
R2099:Lifr UTSW 15 7,186,732 (GRCm39) missense probably benign
R2102:Lifr UTSW 15 7,216,404 (GRCm39) missense probably damaging 1.00
R2136:Lifr UTSW 15 7,211,338 (GRCm39) missense possibly damaging 0.89
R2511:Lifr UTSW 15 7,196,397 (GRCm39) missense probably benign
R4375:Lifr UTSW 15 7,196,379 (GRCm39) missense probably benign
R4883:Lifr UTSW 15 7,215,106 (GRCm39) missense possibly damaging 0.94
R5681:Lifr UTSW 15 7,220,565 (GRCm39) missense probably damaging 1.00
R5689:Lifr UTSW 15 7,214,285 (GRCm39) missense probably damaging 1.00
R5693:Lifr UTSW 15 7,205,041 (GRCm39) missense probably damaging 1.00
R5902:Lifr UTSW 15 7,220,231 (GRCm39) missense probably benign
R5918:Lifr UTSW 15 7,188,897 (GRCm39) missense probably benign 0.00
R5924:Lifr UTSW 15 7,202,453 (GRCm39) missense probably benign 0.28
R6037:Lifr UTSW 15 7,216,424 (GRCm39) missense probably damaging 1.00
R6037:Lifr UTSW 15 7,216,424 (GRCm39) missense probably damaging 1.00
R6289:Lifr UTSW 15 7,196,391 (GRCm39) missense probably benign 0.00
R6339:Lifr UTSW 15 7,196,530 (GRCm39) missense probably benign 0.01
R6860:Lifr UTSW 15 7,202,418 (GRCm39) missense probably benign 0.02
R7106:Lifr UTSW 15 7,202,405 (GRCm39) missense probably benign 0.02
R7107:Lifr UTSW 15 7,208,421 (GRCm39) missense possibly damaging 0.88
R7274:Lifr UTSW 15 7,196,540 (GRCm39) critical splice donor site probably null
R7625:Lifr UTSW 15 7,198,723 (GRCm39) missense probably damaging 0.99
R7631:Lifr UTSW 15 7,214,258 (GRCm39) missense probably damaging 1.00
R7958:Lifr UTSW 15 7,211,478 (GRCm39) missense possibly damaging 0.62
R7991:Lifr UTSW 15 7,202,963 (GRCm39) missense possibly damaging 0.79
R8175:Lifr UTSW 15 7,216,496 (GRCm39) missense probably damaging 1.00
R8427:Lifr UTSW 15 7,220,462 (GRCm39) missense probably benign 0.01
R9274:Lifr UTSW 15 7,217,591 (GRCm39) missense probably damaging 0.98
R9311:Lifr UTSW 15 7,208,418 (GRCm39) missense possibly damaging 0.47
R9365:Lifr UTSW 15 7,198,521 (GRCm39) missense probably damaging 1.00
R9509:Lifr UTSW 15 7,188,955 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAGCACCATGACCGTGCTGAC -3'
(R):5'- CCGCTCAAACAGACTTCAGGGATAC -3'

Sequencing Primer
(F):5'- GTCTCTTCAAAGAAACGTCATCCTG -3'
(R):5'- CTCAGTGTCAAGACTGAAACTGTG -3'
Posted On 2014-05-09