Incidental Mutation 'R1462:Pign'
ID186278
Institutional Source Beutler Lab
Gene Symbol Pign
Ensembl Gene ENSMUSG00000056536
Gene Namephosphatidylinositol glycan anchor biosynthesis, class N
Synonyms
MMRRC Submission 039516-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.540) question?
Stock #R1462 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location105518422-105663677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105585002 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 652 (V652E)
Ref Sequence ENSEMBL: ENSMUSP00000139638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070699] [ENSMUST00000186485] [ENSMUST00000187537] [ENSMUST00000190811]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070699
AA Change: V652E

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000069969
Gene: ENSMUSG00000056536
AA Change: V652E

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Phosphodiest 116 303 1.2e-10 PFAM
Pfam:Sulfatase 148 334 2.1e-8 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 884 2.3e-138 PFAM
transmembrane domain 893 915 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186485
AA Change: V652E

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139638
Gene: ENSMUSG00000056536
AA Change: V652E

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Phosphodiest 109 330 3.7e-11 PFAM
Pfam:Sulfatase 148 334 2.1e-8 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 884 1.5e-141 PFAM
transmembrane domain 893 915 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187537
AA Change: V652E

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140020
Gene: ENSMUSG00000056536
AA Change: V652E

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Phosphodiest 46 331 1.2e-12 PFAM
Pfam:Sulfatase 146 334 2.9e-6 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 800 5.9e-86 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190811
AA Change: V652E

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140844
Gene: ENSMUSG00000056536
AA Change: V652E

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Phosphodiest 46 331 1.1e-12 PFAM
Pfam:Sulfatase 146 334 2.8e-6 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 794 4.4e-86 PFAM
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is expressed in the endoplasmic reticulum and transfers phosphoethanolamine (EtNP) to the first mannose of the GPI anchor. Two alternatively spliced variants, which encode an identical isoform, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal gastrulation, forebrain hypoplasia, coloboma, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C A 7: 40,992,946 S104* probably null Het
A430093F15Rik A T 19: 10,785,481 probably benign Het
Abca13 T A 11: 9,483,924 probably benign Het
Abca9 T C 11: 110,160,516 D118G probably benign Het
AC239677.1 T A 5: 25,951,625 I119F possibly damaging Het
Adamts16 A G 13: 70,836,134 F137L probably benign Het
Adamts3 T C 5: 89,861,349 I152V probably benign Het
Adcy4 T A 14: 55,778,308 E441D possibly damaging Het
Adgra1 T A 7: 139,875,829 Y458N probably damaging Het
Atpaf1 C T 4: 115,784,953 probably benign Het
Bhlhe22 C G 3: 18,055,782 S332C probably damaging Het
Card19 T A 13: 49,205,284 Q71L probably benign Het
Ccdc12 T C 9: 110,656,594 L11P probably damaging Het
Ccdc129 A G 6: 55,975,664 H864R probably damaging Het
Cdadc1 A G 14: 59,575,858 Y367H probably damaging Het
Cdc5l G T 17: 45,408,362 Q542K possibly damaging Het
Cep170 T C 1: 176,756,645 K723E possibly damaging Het
Cep70 A G 9: 99,263,720 I147V probably benign Het
Cfap58 A T 19: 47,962,430 H410L probably damaging Het
Chat T C 14: 32,420,778 K418R probably damaging Het
Cic T G 7: 25,271,607 D254E probably damaging Het
Ckap4 T C 10: 84,527,567 E544G probably damaging Het
Crnkl1 C T 2: 145,921,819 A500T probably damaging Het
Cyp2c38 T C 19: 39,392,188 N418D probably damaging Het
Daam1 A T 12: 71,944,142 I177L unknown Het
Dnah1 T C 14: 31,268,781 probably benign Het
Ercc5 A G 1: 44,180,624 T1019A probably damaging Het
F13b T A 1: 139,507,636 V173E probably damaging Het
Fam126a A G 5: 23,985,732 probably benign Het
Fam135b A G 15: 71,621,996 probably benign Het
Fam20a A C 11: 109,677,317 F316V probably damaging Het
Flrt2 T C 12: 95,779,338 V150A probably damaging Het
Fnta A C 8: 25,999,571 probably null Het
Ghsr A G 3: 27,371,876 D27G probably benign Het
Glis3 G T 19: 28,262,518 probably benign Het
Gm5155 T G 7: 17,915,591 noncoding transcript Het
Gtpbp1 A G 15: 79,707,885 N96D probably damaging Het
H1fnt A T 15: 98,256,573 W232R unknown Het
Ibtk A T 9: 85,724,145 I443N probably damaging Het
Ifi207 T C 1: 173,724,947 H968R probably damaging Het
Ifit2 A G 19: 34,573,186 D42G probably null Het
Il17rc A T 6: 113,478,989 D265V probably damaging Het
Ints10 G A 8: 68,807,644 probably benign Het
Itfg2 T C 6: 128,424,728 D29G probably damaging Het
Kcng3 A T 17: 83,631,063 C186S probably damaging Het
Lrrc1 A G 9: 77,442,265 F295L probably benign Het
Mrps28 T A 3: 8,900,124 H85L possibly damaging Het
Mtpn T A 6: 35,522,758 K37M possibly damaging Het
Mug1 C T 6: 121,882,629 H1196Y probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Musk A G 4: 58,286,204 probably benign Het
Mybl2 T C 2: 163,072,708 S249P probably benign Het
Naip6 A G 13: 100,300,240 Y592H possibly damaging Het
Nrp1 A G 8: 128,502,798 N919S probably benign Het
Nudt9 C T 5: 104,065,038 Q326* probably null Het
Olfr1136 A T 2: 87,693,376 C169S probably damaging Het
Olfr813 A G 10: 129,857,231 T238A probably damaging Het
Olfr827 T A 10: 130,210,723 I136F probably benign Het
Olfr829 T A 9: 18,857,111 M162K probably benign Het
Pcsk4 T C 10: 80,325,981 E142G probably damaging Het
Pde3a C A 6: 141,459,834 P471T probably benign Het
Prkcb T A 7: 122,582,449 M420K probably damaging Het
Prr14 T A 7: 127,473,988 probably null Het
Rchy1 T A 5: 91,957,882 Q69L probably damaging Het
Sccpdh A C 1: 179,681,560 probably benign Het
Sec23ip T G 7: 128,766,138 S625A probably benign Het
Smpdl3b A G 4: 132,746,614 S47P probably damaging Het
Stil G A 4: 115,023,964 M568I probably benign Het
Syt3 T A 7: 44,396,010 V558E probably damaging Het
Sytl3 A G 17: 6,706,031 probably benign Het
Szt2 A G 4: 118,373,967 V2533A unknown Het
Tenm4 A G 7: 96,704,153 Y384C probably damaging Het
Tfam T C 10: 71,235,550 E94G probably damaging Het
Tmbim7 A G 5: 3,664,304 T14A probably damaging Het
Tmtc2 A T 10: 105,573,705 Y15* probably null Het
Uhrf1 C T 17: 56,318,035 A526V probably damaging Het
Vmn2r67 T C 7: 85,155,838 D22G probably benign Het
Vmn2r96 A G 17: 18,597,398 I412M possibly damaging Het
Vmn2r-ps69 T A 7: 85,310,352 noncoding transcript Het
Wdr17 A T 8: 54,670,328 I479K probably damaging Het
Wt1 T C 2: 105,166,831 V371A probably damaging Het
Zfp536 G T 7: 37,479,310 S226Y probably damaging Het
Zfp827 T C 8: 79,076,479 V560A probably benign Het
Other mutations in Pign
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Pign APN 1 105597723 nonsense probably null
IGL00770:Pign APN 1 105597756 missense probably benign 0.00
IGL00774:Pign APN 1 105597756 missense probably benign 0.00
IGL00828:Pign APN 1 105554120 missense probably damaging 0.97
IGL01407:Pign APN 1 105589302 missense probably benign 0.06
IGL01523:Pign APN 1 105653178 missense probably damaging 0.98
IGL01953:Pign APN 1 105589039 splice site probably benign
IGL02389:Pign APN 1 105646781 nonsense probably null
PIT4810001:Pign UTSW 1 105597762 missense possibly damaging 0.83
R0080:Pign UTSW 1 105552405 missense probably damaging 1.00
R0097:Pign UTSW 1 105587976 splice site probably benign
R0302:Pign UTSW 1 105589093 missense possibly damaging 0.83
R0573:Pign UTSW 1 105653177 missense probably damaging 1.00
R0580:Pign UTSW 1 105591694 missense probably benign 0.03
R0946:Pign UTSW 1 105591697 missense probably benign 0.00
R1397:Pign UTSW 1 105657771 missense probably damaging 1.00
R1462:Pign UTSW 1 105585002 missense possibly damaging 0.95
R1751:Pign UTSW 1 105653192 missense probably benign 0.19
R1753:Pign UTSW 1 105589317 missense possibly damaging 0.65
R1767:Pign UTSW 1 105653192 missense probably benign 0.19
R1854:Pign UTSW 1 105554498 missense probably damaging 0.99
R1907:Pign UTSW 1 105638215 missense possibly damaging 0.50
R2845:Pign UTSW 1 105657796 missense possibly damaging 0.80
R2846:Pign UTSW 1 105657796 missense possibly damaging 0.80
R3718:Pign UTSW 1 105649281 critical splice donor site probably null
R3970:Pign UTSW 1 105656003 missense probably damaging 1.00
R4067:Pign UTSW 1 105587978 critical splice donor site probably null
R4110:Pign UTSW 1 105553815 unclassified probably benign
R4387:Pign UTSW 1 105522060 missense possibly damaging 0.48
R4393:Pign UTSW 1 105522026 missense probably benign 0.00
R4472:Pign UTSW 1 105648220 missense probably benign 0.29
R4519:Pign UTSW 1 105597666 critical splice donor site probably null
R4619:Pign UTSW 1 105521990 utr 3 prime probably benign
R4746:Pign UTSW 1 105585024 missense probably benign 0.33
R4859:Pign UTSW 1 105648167 nonsense probably null
R4893:Pign UTSW 1 105646711 missense probably damaging 1.00
R4953:Pign UTSW 1 105644502 missense probably benign 0.32
R5046:Pign UTSW 1 105522073 missense possibly damaging 0.94
R5377:Pign UTSW 1 105657812 missense probably benign 0.12
R5388:Pign UTSW 1 105655970 missense probably damaging 1.00
R5482:Pign UTSW 1 105546710 missense probably benign 0.44
R5594:Pign UTSW 1 105646869 intron probably benign
R5639:Pign UTSW 1 105589315 missense probably benign 0.09
R5778:Pign UTSW 1 105591722 missense probably damaging 1.00
R5821:Pign UTSW 1 105589063 missense possibly damaging 0.95
R5928:Pign UTSW 1 105558067 missense possibly damaging 0.55
R5979:Pign UTSW 1 105589274 missense probably benign 0.01
R6213:Pign UTSW 1 105589266 missense possibly damaging 0.50
R6292:Pign UTSW 1 105585077 missense possibly damaging 0.69
R6343:Pign UTSW 1 105585095 missense probably benign 0.33
R6566:Pign UTSW 1 105638181 critical splice donor site probably null
R6856:Pign UTSW 1 105553895 nonsense probably null
R6954:Pign UTSW 1 105553897 missense probably benign 0.39
X0025:Pign UTSW 1 105657634 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGTCACCTTCACTGCGGATTTCTTG -3'
(R):5'- AACTAGCACTGCCATGTGCTTGCC -3'

Sequencing Primer
(F):5'- ACTGCGGATTTCTTGACATCAC -3'
(R):5'- AGGTCTCCATTTGAGTAAAGTGCC -3'
Posted On2014-05-09