Incidental Mutation 'R1462:Mybl2'
ID186286
Institutional Source Beutler Lab
Gene Symbol Mybl2
Ensembl Gene ENSMUSG00000017861
Gene Namemyeloblastosis oncogene-like 2
SynonymsB-Myb, Bmyb
MMRRC Submission 039516-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1462 (G1)
Quality Score111
Status Validated
Chromosome2
Chromosomal Location163054687-163084688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 163072708 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 249 (S249P)
Ref Sequence ENSEMBL: ENSMUSP00000018005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018005] [ENSMUST00000142729]
PDB Structure
Solution Structure of RSGI RUH-050, a myb DNA-binding domain in mouse cDNA [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000018005
AA Change: S249P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018005
Gene: ENSMUSG00000017861
AA Change: S249P

DomainStartEndE-ValueType
SANT 30 79 1.38e-16 SMART
SANT 82 131 5.77e-19 SMART
SANT 134 182 2.12e-17 SMART
low complexity region 232 252 N/A INTRINSIC
low complexity region 339 366 N/A INTRINSIC
Pfam:Cmyb_C 454 610 6.4e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138414
Predicted Effect probably benign
Transcript: ENSMUST00000142729
SMART Domains Protein: ENSMUSP00000114710
Gene: ENSMUSG00000017861

DomainStartEndE-ValueType
Pfam:Cmyb_C 16 71 1.9e-23 PFAM
Pfam:Cmyb_C 99 215 4e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184607
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, a member of the MYB family of transcription factor genes, is a nuclear protein involved in cell cycle progression. The encoded protein is phosphorylated by cyclin A/cyclin-dependent kinase 2 during the S-phase of the cell cycle and possesses both activator and repressor activities. It has been shown to activate the cell division cycle 2, cyclin D1, and insulin-like growth factor-binding protein 5 genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos shortly after implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C A 7: 40,992,946 S104* probably null Het
A430093F15Rik A T 19: 10,785,481 probably benign Het
Abca13 T A 11: 9,483,924 probably benign Het
Abca9 T C 11: 110,160,516 D118G probably benign Het
AC239677.1 T A 5: 25,951,625 I119F possibly damaging Het
Adamts16 A G 13: 70,836,134 F137L probably benign Het
Adamts3 T C 5: 89,861,349 I152V probably benign Het
Adcy4 T A 14: 55,778,308 E441D possibly damaging Het
Adgra1 T A 7: 139,875,829 Y458N probably damaging Het
Atpaf1 C T 4: 115,784,953 probably benign Het
Bhlhe22 C G 3: 18,055,782 S332C probably damaging Het
Card19 T A 13: 49,205,284 Q71L probably benign Het
Ccdc12 T C 9: 110,656,594 L11P probably damaging Het
Ccdc129 A G 6: 55,975,664 H864R probably damaging Het
Cdadc1 A G 14: 59,575,858 Y367H probably damaging Het
Cdc5l G T 17: 45,408,362 Q542K possibly damaging Het
Cep170 T C 1: 176,756,645 K723E possibly damaging Het
Cep70 A G 9: 99,263,720 I147V probably benign Het
Cfap58 A T 19: 47,962,430 H410L probably damaging Het
Chat T C 14: 32,420,778 K418R probably damaging Het
Cic T G 7: 25,271,607 D254E probably damaging Het
Ckap4 T C 10: 84,527,567 E544G probably damaging Het
Crnkl1 C T 2: 145,921,819 A500T probably damaging Het
Cyp2c38 T C 19: 39,392,188 N418D probably damaging Het
Daam1 A T 12: 71,944,142 I177L unknown Het
Dnah1 T C 14: 31,268,781 probably benign Het
Ercc5 A G 1: 44,180,624 T1019A probably damaging Het
F13b T A 1: 139,507,636 V173E probably damaging Het
Fam126a A G 5: 23,985,732 probably benign Het
Fam135b A G 15: 71,621,996 probably benign Het
Fam20a A C 11: 109,677,317 F316V probably damaging Het
Flrt2 T C 12: 95,779,338 V150A probably damaging Het
Fnta A C 8: 25,999,571 probably null Het
Ghsr A G 3: 27,371,876 D27G probably benign Het
Glis3 G T 19: 28,262,518 probably benign Het
Gm5155 T G 7: 17,915,591 noncoding transcript Het
Gtpbp1 A G 15: 79,707,885 N96D probably damaging Het
H1fnt A T 15: 98,256,573 W232R unknown Het
Ibtk A T 9: 85,724,145 I443N probably damaging Het
Ifi207 T C 1: 173,724,947 H968R probably damaging Het
Ifit2 A G 19: 34,573,186 D42G probably null Het
Il17rc A T 6: 113,478,989 D265V probably damaging Het
Ints10 G A 8: 68,807,644 probably benign Het
Itfg2 T C 6: 128,424,728 D29G probably damaging Het
Kcng3 A T 17: 83,631,063 C186S probably damaging Het
Lrrc1 A G 9: 77,442,265 F295L probably benign Het
Mrps28 T A 3: 8,900,124 H85L possibly damaging Het
Mtpn T A 6: 35,522,758 K37M possibly damaging Het
Mug1 C T 6: 121,882,629 H1196Y probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Musk A G 4: 58,286,204 probably benign Het
Naip6 A G 13: 100,300,240 Y592H possibly damaging Het
Nrp1 A G 8: 128,502,798 N919S probably benign Het
Nudt9 C T 5: 104,065,038 Q326* probably null Het
Olfr1136 A T 2: 87,693,376 C169S probably damaging Het
Olfr813 A G 10: 129,857,231 T238A probably damaging Het
Olfr827 T A 10: 130,210,723 I136F probably benign Het
Olfr829 T A 9: 18,857,111 M162K probably benign Het
Pcsk4 T C 10: 80,325,981 E142G probably damaging Het
Pde3a C A 6: 141,459,834 P471T probably benign Het
Pign A T 1: 105,585,002 V652E possibly damaging Het
Prkcb T A 7: 122,582,449 M420K probably damaging Het
Prr14 T A 7: 127,473,988 probably null Het
Rchy1 T A 5: 91,957,882 Q69L probably damaging Het
Sccpdh A C 1: 179,681,560 probably benign Het
Sec23ip T G 7: 128,766,138 S625A probably benign Het
Smpdl3b A G 4: 132,746,614 S47P probably damaging Het
Stil G A 4: 115,023,964 M568I probably benign Het
Syt3 T A 7: 44,396,010 V558E probably damaging Het
Sytl3 A G 17: 6,706,031 probably benign Het
Szt2 A G 4: 118,373,967 V2533A unknown Het
Tenm4 A G 7: 96,704,153 Y384C probably damaging Het
Tfam T C 10: 71,235,550 E94G probably damaging Het
Tmbim7 A G 5: 3,664,304 T14A probably damaging Het
Tmtc2 A T 10: 105,573,705 Y15* probably null Het
Uhrf1 C T 17: 56,318,035 A526V probably damaging Het
Vmn2r67 T C 7: 85,155,838 D22G probably benign Het
Vmn2r96 A G 17: 18,597,398 I412M possibly damaging Het
Vmn2r-ps69 T A 7: 85,310,352 noncoding transcript Het
Wdr17 A T 8: 54,670,328 I479K probably damaging Het
Wt1 T C 2: 105,166,831 V371A probably damaging Het
Zfp536 G T 7: 37,479,310 S226Y probably damaging Het
Zfp827 T C 8: 79,076,479 V560A probably benign Het
Other mutations in Mybl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02331:Mybl2 APN 2 163074685 missense probably damaging 1.00
IGL03112:Mybl2 APN 2 163062536 missense probably damaging 1.00
R0129:Mybl2 UTSW 2 163059491 splice site probably benign
R0393:Mybl2 UTSW 2 163061608 splice site probably benign
R0488:Mybl2 UTSW 2 163072614 unclassified probably benign
R0839:Mybl2 UTSW 2 163075768 missense probably benign 0.00
R1268:Mybl2 UTSW 2 163074716 missense probably benign 0.06
R1462:Mybl2 UTSW 2 163072708 missense probably benign
R1667:Mybl2 UTSW 2 163075696 missense probably damaging 1.00
R1829:Mybl2 UTSW 2 163059583 missense probably benign 0.41
R4793:Mybl2 UTSW 2 163074763 missense probably damaging 1.00
R4953:Mybl2 UTSW 2 163080796 missense probably damaging 1.00
R5738:Mybl2 UTSW 2 163068283 nonsense probably null
R6524:Mybl2 UTSW 2 163074530 missense possibly damaging 0.65
R6957:Mybl2 UTSW 2 163072808 missense possibly damaging 0.86
R7223:Mybl2 UTSW 2 163072705 missense probably benign 0.00
R7244:Mybl2 UTSW 2 163082685 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ATGCATCAGCCTCATTGGCCTC -3'
(R):5'- ACCTGCTGGGATCAACATACCGAC -3'

Sequencing Primer
(F):5'- tgaaatgtctctcaatttctgtcc -3'
(R):5'- ATCAAGTCCAGAGCTTCAGAG -3'
Posted On2014-05-09