Incidental Mutation 'R1462:Adamts3'
ID186298
Institutional Source Beutler Lab
Gene Symbol Adamts3
Ensembl Gene ENSMUSG00000043635
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3
Synonyms6330442E02Rik, 1100001H14Rik
MMRRC Submission 039516-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.461) question?
Stock #R1462 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location89677087-89883334 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89861349 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 152 (I152V)
Ref Sequence ENSEMBL: ENSMUSP00000142771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159] [ENSMUST00000198151]
Predicted Effect probably benign
Transcript: ENSMUST00000061427
AA Change: I152V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: I152V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 201 5.1e-40 PFAM
Pfam:Reprolysin_5 254 439 5.4e-15 PFAM
Pfam:Reprolysin_4 256 454 1.9e-10 PFAM
Pfam:Reprolysin 257 460 3.6e-22 PFAM
Pfam:Reprolysin_2 274 451 7.7e-13 PFAM
Pfam:Reprolysin_3 278 409 1.5e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 827 3e-34 PFAM
TSP1 848 905 4.35e-2 SMART
TSP1 908 967 4.95e-2 SMART
TSP1 969 1016 6.58e-5 SMART
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1157 1177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163159
AA Change: I152V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: I152V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 201 1.5e-40 PFAM
Pfam:Reprolysin_5 254 439 2.2e-15 PFAM
Pfam:Reprolysin_4 256 454 7.7e-11 PFAM
Pfam:Reprolysin 257 460 3.7e-21 PFAM
Pfam:Reprolysin_2 274 451 4.3e-14 PFAM
Pfam:Reprolysin_3 278 409 1.3e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 828 3.6e-28 PFAM
TSP1 849 906 4.35e-2 SMART
TSP1 909 968 4.95e-2 SMART
TSP1 970 1017 6.58e-5 SMART
low complexity region 1115 1129 N/A INTRINSIC
low complexity region 1158 1178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196507
Predicted Effect probably benign
Transcript: ENSMUST00000198151
AA Change: I152V

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000142771
Gene: ENSMUSG00000043635
AA Change: I152V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 174 2.3e-29 PFAM
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C A 7: 40,992,946 S104* probably null Het
A430093F15Rik A T 19: 10,785,481 probably benign Het
Abca13 T A 11: 9,483,924 probably benign Het
Abca9 T C 11: 110,160,516 D118G probably benign Het
AC239677.1 T A 5: 25,951,625 I119F possibly damaging Het
Adamts16 A G 13: 70,836,134 F137L probably benign Het
Adcy4 T A 14: 55,778,308 E441D possibly damaging Het
Adgra1 T A 7: 139,875,829 Y458N probably damaging Het
Atpaf1 C T 4: 115,784,953 probably benign Het
Bhlhe22 C G 3: 18,055,782 S332C probably damaging Het
Card19 T A 13: 49,205,284 Q71L probably benign Het
Ccdc12 T C 9: 110,656,594 L11P probably damaging Het
Ccdc129 A G 6: 55,975,664 H864R probably damaging Het
Cdadc1 A G 14: 59,575,858 Y367H probably damaging Het
Cdc5l G T 17: 45,408,362 Q542K possibly damaging Het
Cep170 T C 1: 176,756,645 K723E possibly damaging Het
Cep70 A G 9: 99,263,720 I147V probably benign Het
Cfap58 A T 19: 47,962,430 H410L probably damaging Het
Chat T C 14: 32,420,778 K418R probably damaging Het
Cic T G 7: 25,271,607 D254E probably damaging Het
Ckap4 T C 10: 84,527,567 E544G probably damaging Het
Crnkl1 C T 2: 145,921,819 A500T probably damaging Het
Cyp2c38 T C 19: 39,392,188 N418D probably damaging Het
Daam1 A T 12: 71,944,142 I177L unknown Het
Dnah1 T C 14: 31,268,781 probably benign Het
Ercc5 A G 1: 44,180,624 T1019A probably damaging Het
F13b T A 1: 139,507,636 V173E probably damaging Het
Fam126a A G 5: 23,985,732 probably benign Het
Fam135b A G 15: 71,621,996 probably benign Het
Fam20a A C 11: 109,677,317 F316V probably damaging Het
Flrt2 T C 12: 95,779,338 V150A probably damaging Het
Fnta A C 8: 25,999,571 probably null Het
Ghsr A G 3: 27,371,876 D27G probably benign Het
Glis3 G T 19: 28,262,518 probably benign Het
Gm5155 T G 7: 17,915,591 noncoding transcript Het
Gtpbp1 A G 15: 79,707,885 N96D probably damaging Het
H1fnt A T 15: 98,256,573 W232R unknown Het
Ibtk A T 9: 85,724,145 I443N probably damaging Het
Ifi207 T C 1: 173,724,947 H968R probably damaging Het
Ifit2 A G 19: 34,573,186 D42G probably null Het
Il17rc A T 6: 113,478,989 D265V probably damaging Het
Ints10 G A 8: 68,807,644 probably benign Het
Itfg2 T C 6: 128,424,728 D29G probably damaging Het
Kcng3 A T 17: 83,631,063 C186S probably damaging Het
Lrrc1 A G 9: 77,442,265 F295L probably benign Het
Mrps28 T A 3: 8,900,124 H85L possibly damaging Het
Mtpn T A 6: 35,522,758 K37M possibly damaging Het
Mug1 C T 6: 121,882,629 H1196Y probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Musk A G 4: 58,286,204 probably benign Het
Mybl2 T C 2: 163,072,708 S249P probably benign Het
Naip6 A G 13: 100,300,240 Y592H possibly damaging Het
Nrp1 A G 8: 128,502,798 N919S probably benign Het
Nudt9 C T 5: 104,065,038 Q326* probably null Het
Olfr1136 A T 2: 87,693,376 C169S probably damaging Het
Olfr813 A G 10: 129,857,231 T238A probably damaging Het
Olfr827 T A 10: 130,210,723 I136F probably benign Het
Olfr829 T A 9: 18,857,111 M162K probably benign Het
Pcsk4 T C 10: 80,325,981 E142G probably damaging Het
Pde3a C A 6: 141,459,834 P471T probably benign Het
Pign A T 1: 105,585,002 V652E possibly damaging Het
Prkcb T A 7: 122,582,449 M420K probably damaging Het
Prr14 T A 7: 127,473,988 probably null Het
Rchy1 T A 5: 91,957,882 Q69L probably damaging Het
Sccpdh A C 1: 179,681,560 probably benign Het
Sec23ip T G 7: 128,766,138 S625A probably benign Het
Smpdl3b A G 4: 132,746,614 S47P probably damaging Het
Stil G A 4: 115,023,964 M568I probably benign Het
Syt3 T A 7: 44,396,010 V558E probably damaging Het
Sytl3 A G 17: 6,706,031 probably benign Het
Szt2 A G 4: 118,373,967 V2533A unknown Het
Tenm4 A G 7: 96,704,153 Y384C probably damaging Het
Tfam T C 10: 71,235,550 E94G probably damaging Het
Tmbim7 A G 5: 3,664,304 T14A probably damaging Het
Tmtc2 A T 10: 105,573,705 Y15* probably null Het
Uhrf1 C T 17: 56,318,035 A526V probably damaging Het
Vmn2r67 T C 7: 85,155,838 D22G probably benign Het
Vmn2r96 A G 17: 18,597,398 I412M possibly damaging Het
Vmn2r-ps69 T A 7: 85,310,352 noncoding transcript Het
Wdr17 A T 8: 54,670,328 I479K probably damaging Het
Wt1 T C 2: 105,166,831 V371A probably damaging Het
Zfp536 G T 7: 37,479,310 S226Y probably damaging Het
Zfp827 T C 8: 79,076,479 V560A probably benign Het
Other mutations in Adamts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Adamts3 APN 5 89861325 missense probably damaging 1.00
IGL00340:Adamts3 APN 5 89701666 missense probably damaging 1.00
IGL00923:Adamts3 APN 5 89684376 missense probably benign 0.06
IGL01420:Adamts3 APN 5 89703057 missense possibly damaging 0.57
IGL01522:Adamts3 APN 5 89702943 missense probably benign 0.14
IGL01676:Adamts3 APN 5 89677754 missense probably benign 0.00
IGL01676:Adamts3 APN 5 89881543 missense possibly damaging 0.54
IGL01678:Adamts3 APN 5 89707856 missense probably damaging 1.00
IGL01936:Adamts3 APN 5 89861423 missense probably benign 0.00
IGL01956:Adamts3 APN 5 89677911 missense probably damaging 0.99
IGL02342:Adamts3 APN 5 89691473 splice site probably null
IGL02415:Adamts3 APN 5 89706647 splice site probably null
IGL03261:Adamts3 APN 5 89882897 utr 5 prime probably benign
IGL03301:Adamts3 APN 5 89707404 missense probably damaging 1.00
R0041:Adamts3 UTSW 5 89684467 missense probably benign
R0079:Adamts3 UTSW 5 89693053 missense probably benign 0.00
R0096:Adamts3 UTSW 5 89701717 nonsense probably null
R0096:Adamts3 UTSW 5 89701717 nonsense probably null
R0477:Adamts3 UTSW 5 89684507 missense probably benign
R0605:Adamts3 UTSW 5 89861475 missense possibly damaging 0.96
R1036:Adamts3 UTSW 5 89696093 splice site probably benign
R1462:Adamts3 UTSW 5 89861349 missense probably benign 0.17
R1621:Adamts3 UTSW 5 89721701 missense probably damaging 1.00
R1799:Adamts3 UTSW 5 89775421 missense probably benign 0.00
R2163:Adamts3 UTSW 5 89708718 missense probably damaging 0.99
R2412:Adamts3 UTSW 5 89701771 missense probably damaging 0.99
R2420:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2421:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2422:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2921:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R2922:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R2923:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R3402:Adamts3 UTSW 5 89701733 missense probably benign 0.04
R3431:Adamts3 UTSW 5 89707453 splice site probably benign
R3432:Adamts3 UTSW 5 89707453 splice site probably benign
R3813:Adamts3 UTSW 5 89677926 missense possibly damaging 0.67
R3816:Adamts3 UTSW 5 89705264 missense probably damaging 0.99
R3905:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3906:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3907:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3908:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R4557:Adamts3 UTSW 5 89700487 missense probably benign 0.03
R4684:Adamts3 UTSW 5 89703007 missense probably damaging 0.98
R4844:Adamts3 UTSW 5 89677816 missense probably damaging 0.99
R4925:Adamts3 UTSW 5 89684323 missense probably benign 0.01
R5097:Adamts3 UTSW 5 89693050 missense probably damaging 0.97
R5100:Adamts3 UTSW 5 89708643 missense probably damaging 1.00
R5237:Adamts3 UTSW 5 89775377 missense probably benign
R5265:Adamts3 UTSW 5 89861552 missense possibly damaging 0.91
R5322:Adamts3 UTSW 5 89707300 splice site probably null
R5413:Adamts3 UTSW 5 89708767 missense probably damaging 1.00
R5459:Adamts3 UTSW 5 89691473 splice site probably null
R5738:Adamts3 UTSW 5 89708668 missense probably damaging 1.00
R5979:Adamts3 UTSW 5 89861669 missense probably damaging 0.96
R5992:Adamts3 UTSW 5 89691335 missense probably damaging 1.00
R6364:Adamts3 UTSW 5 89721814 missense possibly damaging 0.92
R6572:Adamts3 UTSW 5 89861609 missense possibly damaging 0.87
R7098:Adamts3 UTSW 5 89861495 missense probably damaging 1.00
X0064:Adamts3 UTSW 5 89703042 missense possibly damaging 0.75
Z1088:Adamts3 UTSW 5 89684449 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGAGCAGAGGAGTCCTGCCAAAC -3'
(R):5'- TCAACGTCACGGCATTTGGAAGAG -3'

Sequencing Primer
(F):5'- AAACCCACTATGCTGCCTATAGTTG -3'
(R):5'- GAGATTTTCATCTTCGACTGAAGCC -3'
Posted On2014-05-09