Incidental Mutation 'R1462:Mtpn'
ID186301
Institutional Source Beutler Lab
Gene Symbol Mtpn
Ensembl Gene ENSMUSG00000029840
Gene Namemyotrophin
SynonymsGcdp, V1, 5033418D15Rik
MMRRC Submission 039516-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R1462 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location35508906-35539888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35522758 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 37 (K37M)
Ref Sequence ENSEMBL: ENSMUSP00000031866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031866] [ENSMUST00000201026]
PDB Structure
Solution NMR structure of V-1 bound to capping protein (CP) [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031866
AA Change: K37M

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031866
Gene: ENSMUSG00000029840
AA Change: K37M

DomainStartEndE-ValueType
Blast:ANK 1 30 8e-9 BLAST
ANK 34 63 7.64e-6 SMART
ANK 67 96 1.14e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175136
Predicted Effect probably benign
Transcript: ENSMUST00000201026
AA Change: K30M

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144482
Gene: ENSMUSG00000029840
AA Change: K30M

DomainStartEndE-ValueType
ANK 27 56 5e-8 SMART
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transcript produced from this gene is bi-cistronic and can encode both myotrophin and leucine zipper protein 6. The myotrophin protein is associated with cardiac hypertrophy, where it is involved in the conversion of NFkappa B p50-p65 heterodimers to p50-p50 and p65-p65 homodimers. This protein also has a potential function in cerebellar morphogenesis, and it may be involved in the differentiation of cerebellar neurons, particularly of granule cells. A cryptic ORF at the 3' end of this transcript uses a novel internal ribosome entry site and a non-AUG translation initiation codon to produce leucine zipper protein 6, a 6.4 kDa tumor antigen that is associated with myeloproliferative disease. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C A 7: 40,992,946 S104* probably null Het
A430093F15Rik A T 19: 10,785,481 probably benign Het
Abca13 T A 11: 9,483,924 probably benign Het
Abca9 T C 11: 110,160,516 D118G probably benign Het
AC239677.1 T A 5: 25,951,625 I119F possibly damaging Het
Adamts16 A G 13: 70,836,134 F137L probably benign Het
Adamts3 T C 5: 89,861,349 I152V probably benign Het
Adcy4 T A 14: 55,778,308 E441D possibly damaging Het
Adgra1 T A 7: 139,875,829 Y458N probably damaging Het
Atpaf1 C T 4: 115,784,953 probably benign Het
Bhlhe22 C G 3: 18,055,782 S332C probably damaging Het
Card19 T A 13: 49,205,284 Q71L probably benign Het
Ccdc12 T C 9: 110,656,594 L11P probably damaging Het
Ccdc129 A G 6: 55,975,664 H864R probably damaging Het
Cdadc1 A G 14: 59,575,858 Y367H probably damaging Het
Cdc5l G T 17: 45,408,362 Q542K possibly damaging Het
Cep170 T C 1: 176,756,645 K723E possibly damaging Het
Cep70 A G 9: 99,263,720 I147V probably benign Het
Cfap58 A T 19: 47,962,430 H410L probably damaging Het
Chat T C 14: 32,420,778 K418R probably damaging Het
Cic T G 7: 25,271,607 D254E probably damaging Het
Ckap4 T C 10: 84,527,567 E544G probably damaging Het
Crnkl1 C T 2: 145,921,819 A500T probably damaging Het
Cyp2c38 T C 19: 39,392,188 N418D probably damaging Het
Daam1 A T 12: 71,944,142 I177L unknown Het
Dnah1 T C 14: 31,268,781 probably benign Het
Ercc5 A G 1: 44,180,624 T1019A probably damaging Het
F13b T A 1: 139,507,636 V173E probably damaging Het
Fam126a A G 5: 23,985,732 probably benign Het
Fam135b A G 15: 71,621,996 probably benign Het
Fam20a A C 11: 109,677,317 F316V probably damaging Het
Flrt2 T C 12: 95,779,338 V150A probably damaging Het
Fnta A C 8: 25,999,571 probably null Het
Ghsr A G 3: 27,371,876 D27G probably benign Het
Glis3 G T 19: 28,262,518 probably benign Het
Gm5155 T G 7: 17,915,591 noncoding transcript Het
Gtpbp1 A G 15: 79,707,885 N96D probably damaging Het
H1fnt A T 15: 98,256,573 W232R unknown Het
Ibtk A T 9: 85,724,145 I443N probably damaging Het
Ifi207 T C 1: 173,724,947 H968R probably damaging Het
Ifit2 A G 19: 34,573,186 D42G probably null Het
Il17rc A T 6: 113,478,989 D265V probably damaging Het
Ints10 G A 8: 68,807,644 probably benign Het
Itfg2 T C 6: 128,424,728 D29G probably damaging Het
Kcng3 A T 17: 83,631,063 C186S probably damaging Het
Lrrc1 A G 9: 77,442,265 F295L probably benign Het
Mrps28 T A 3: 8,900,124 H85L possibly damaging Het
Mug1 C T 6: 121,882,629 H1196Y probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Musk A G 4: 58,286,204 probably benign Het
Mybl2 T C 2: 163,072,708 S249P probably benign Het
Naip6 A G 13: 100,300,240 Y592H possibly damaging Het
Nrp1 A G 8: 128,502,798 N919S probably benign Het
Nudt9 C T 5: 104,065,038 Q326* probably null Het
Olfr1136 A T 2: 87,693,376 C169S probably damaging Het
Olfr813 A G 10: 129,857,231 T238A probably damaging Het
Olfr827 T A 10: 130,210,723 I136F probably benign Het
Olfr829 T A 9: 18,857,111 M162K probably benign Het
Pcsk4 T C 10: 80,325,981 E142G probably damaging Het
Pde3a C A 6: 141,459,834 P471T probably benign Het
Pign A T 1: 105,585,002 V652E possibly damaging Het
Prkcb T A 7: 122,582,449 M420K probably damaging Het
Prr14 T A 7: 127,473,988 probably null Het
Rchy1 T A 5: 91,957,882 Q69L probably damaging Het
Sccpdh A C 1: 179,681,560 probably benign Het
Sec23ip T G 7: 128,766,138 S625A probably benign Het
Smpdl3b A G 4: 132,746,614 S47P probably damaging Het
Stil G A 4: 115,023,964 M568I probably benign Het
Syt3 T A 7: 44,396,010 V558E probably damaging Het
Sytl3 A G 17: 6,706,031 probably benign Het
Szt2 A G 4: 118,373,967 V2533A unknown Het
Tenm4 A G 7: 96,704,153 Y384C probably damaging Het
Tfam T C 10: 71,235,550 E94G probably damaging Het
Tmbim7 A G 5: 3,664,304 T14A probably damaging Het
Tmtc2 A T 10: 105,573,705 Y15* probably null Het
Uhrf1 C T 17: 56,318,035 A526V probably damaging Het
Vmn2r67 T C 7: 85,155,838 D22G probably benign Het
Vmn2r96 A G 17: 18,597,398 I412M possibly damaging Het
Vmn2r-ps69 T A 7: 85,310,352 noncoding transcript Het
Wdr17 A T 8: 54,670,328 I479K probably damaging Het
Wt1 T C 2: 105,166,831 V371A probably damaging Het
Zfp536 G T 7: 37,479,310 S226Y probably damaging Het
Zfp827 T C 8: 79,076,479 V560A probably benign Het
Other mutations in Mtpn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Mtpn APN 6 35522776 missense probably damaging 0.96
IGL00957:Mtpn APN 6 35539612 utr 5 prime probably benign
IGL03238:Mtpn APN 6 35522773 missense probably damaging 1.00
lamco UTSW 6 35522758 missense possibly damaging 0.65
R0972:Mtpn UTSW 6 35521976 missense probably null 0.78
R1311:Mtpn UTSW 6 35512250 missense possibly damaging 0.94
R1462:Mtpn UTSW 6 35522758 missense possibly damaging 0.65
R3076:Mtpn UTSW 6 35521944 missense possibly damaging 0.67
R5297:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5334:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5336:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5337:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5512:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5809:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5841:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5842:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5843:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5844:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5846:Mtpn UTSW 6 35512290 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTACAGTGTCAACTTGGCAAGG -3'
(R):5'- TGGTAAGCTACCTGCATTGGAAGC -3'

Sequencing Primer
(F):5'- GTCAACTTGGCAAGGTTTAGAAC -3'
(R):5'- TGCATTGGAAGCCATGCC -3'
Posted On2014-05-09