Incidental Mutation 'R1462:Ccdc129'
ID186302
Institutional Source Beutler Lab
Gene Symbol Ccdc129
Ensembl Gene ENSMUSG00000037973
Gene Namecoiled-coil domain containing 129
SynonymsD530004J12Rik
MMRRC Submission 039516-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.023) question?
Stock #R1462 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location55836895-55978735 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55975664 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 864 (H864R)
Ref Sequence ENSEMBL: ENSMUSP00000045332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044729]
Predicted Effect probably damaging
Transcript: ENSMUST00000044729
AA Change: H864R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045332
Gene: ENSMUSG00000037973
AA Change: H864R

DomainStartEndE-ValueType
KRAP_IP3R_bind 112 264 2.99e-82 SMART
low complexity region 326 334 N/A INTRINSIC
low complexity region 432 442 N/A INTRINSIC
low complexity region 477 496 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
Pfam:SSFA2_C 806 916 3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169699
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C A 7: 40,992,946 S104* probably null Het
A430093F15Rik A T 19: 10,785,481 probably benign Het
Abca13 T A 11: 9,483,924 probably benign Het
Abca9 T C 11: 110,160,516 D118G probably benign Het
AC239677.1 T A 5: 25,951,625 I119F possibly damaging Het
Adamts16 A G 13: 70,836,134 F137L probably benign Het
Adamts3 T C 5: 89,861,349 I152V probably benign Het
Adcy4 T A 14: 55,778,308 E441D possibly damaging Het
Adgra1 T A 7: 139,875,829 Y458N probably damaging Het
Atpaf1 C T 4: 115,784,953 probably benign Het
Bhlhe22 C G 3: 18,055,782 S332C probably damaging Het
Card19 T A 13: 49,205,284 Q71L probably benign Het
Ccdc12 T C 9: 110,656,594 L11P probably damaging Het
Cdadc1 A G 14: 59,575,858 Y367H probably damaging Het
Cdc5l G T 17: 45,408,362 Q542K possibly damaging Het
Cep170 T C 1: 176,756,645 K723E possibly damaging Het
Cep70 A G 9: 99,263,720 I147V probably benign Het
Cfap58 A T 19: 47,962,430 H410L probably damaging Het
Chat T C 14: 32,420,778 K418R probably damaging Het
Cic T G 7: 25,271,607 D254E probably damaging Het
Ckap4 T C 10: 84,527,567 E544G probably damaging Het
Crnkl1 C T 2: 145,921,819 A500T probably damaging Het
Cyp2c38 T C 19: 39,392,188 N418D probably damaging Het
Daam1 A T 12: 71,944,142 I177L unknown Het
Dnah1 T C 14: 31,268,781 probably benign Het
Ercc5 A G 1: 44,180,624 T1019A probably damaging Het
F13b T A 1: 139,507,636 V173E probably damaging Het
Fam126a A G 5: 23,985,732 probably benign Het
Fam135b A G 15: 71,621,996 probably benign Het
Fam20a A C 11: 109,677,317 F316V probably damaging Het
Flrt2 T C 12: 95,779,338 V150A probably damaging Het
Fnta A C 8: 25,999,571 probably null Het
Ghsr A G 3: 27,371,876 D27G probably benign Het
Glis3 G T 19: 28,262,518 probably benign Het
Gm5155 T G 7: 17,915,591 noncoding transcript Het
Gtpbp1 A G 15: 79,707,885 N96D probably damaging Het
H1fnt A T 15: 98,256,573 W232R unknown Het
Ibtk A T 9: 85,724,145 I443N probably damaging Het
Ifi207 T C 1: 173,724,947 H968R probably damaging Het
Ifit2 A G 19: 34,573,186 D42G probably null Het
Il17rc A T 6: 113,478,989 D265V probably damaging Het
Ints10 G A 8: 68,807,644 probably benign Het
Itfg2 T C 6: 128,424,728 D29G probably damaging Het
Kcng3 A T 17: 83,631,063 C186S probably damaging Het
Lrrc1 A G 9: 77,442,265 F295L probably benign Het
Mrps28 T A 3: 8,900,124 H85L possibly damaging Het
Mtpn T A 6: 35,522,758 K37M possibly damaging Het
Mug1 C T 6: 121,882,629 H1196Y probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Musk A G 4: 58,286,204 probably benign Het
Mybl2 T C 2: 163,072,708 S249P probably benign Het
Naip6 A G 13: 100,300,240 Y592H possibly damaging Het
Nrp1 A G 8: 128,502,798 N919S probably benign Het
Nudt9 C T 5: 104,065,038 Q326* probably null Het
Olfr1136 A T 2: 87,693,376 C169S probably damaging Het
Olfr813 A G 10: 129,857,231 T238A probably damaging Het
Olfr827 T A 10: 130,210,723 I136F probably benign Het
Olfr829 T A 9: 18,857,111 M162K probably benign Het
Pcsk4 T C 10: 80,325,981 E142G probably damaging Het
Pde3a C A 6: 141,459,834 P471T probably benign Het
Pign A T 1: 105,585,002 V652E possibly damaging Het
Prkcb T A 7: 122,582,449 M420K probably damaging Het
Prr14 T A 7: 127,473,988 probably null Het
Rchy1 T A 5: 91,957,882 Q69L probably damaging Het
Sccpdh A C 1: 179,681,560 probably benign Het
Sec23ip T G 7: 128,766,138 S625A probably benign Het
Smpdl3b A G 4: 132,746,614 S47P probably damaging Het
Stil G A 4: 115,023,964 M568I probably benign Het
Syt3 T A 7: 44,396,010 V558E probably damaging Het
Sytl3 A G 17: 6,706,031 probably benign Het
Szt2 A G 4: 118,373,967 V2533A unknown Het
Tenm4 A G 7: 96,704,153 Y384C probably damaging Het
Tfam T C 10: 71,235,550 E94G probably damaging Het
Tmbim7 A G 5: 3,664,304 T14A probably damaging Het
Tmtc2 A T 10: 105,573,705 Y15* probably null Het
Uhrf1 C T 17: 56,318,035 A526V probably damaging Het
Vmn2r67 T C 7: 85,155,838 D22G probably benign Het
Vmn2r96 A G 17: 18,597,398 I412M possibly damaging Het
Vmn2r-ps69 T A 7: 85,310,352 noncoding transcript Het
Wdr17 A T 8: 54,670,328 I479K probably damaging Het
Wt1 T C 2: 105,166,831 V371A probably damaging Het
Zfp536 G T 7: 37,479,310 S226Y probably damaging Het
Zfp827 T C 8: 79,076,479 V560A probably benign Het
Other mutations in Ccdc129
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ccdc129 APN 6 55968037 missense possibly damaging 0.90
IGL01317:Ccdc129 APN 6 55967805 missense possibly damaging 0.77
IGL01390:Ccdc129 APN 6 55897998 missense probably benign 0.41
IGL01696:Ccdc129 APN 6 55897695 missense probably benign 0.40
IGL01941:Ccdc129 APN 6 55968045 missense probably benign
IGL01967:Ccdc129 APN 6 55897911 missense probably damaging 0.99
IGL02071:Ccdc129 APN 6 55967725 nonsense probably null
IGL02232:Ccdc129 APN 6 55967937 missense unknown
IGL02268:Ccdc129 APN 6 55884688 splice site probably benign
IGL02440:Ccdc129 APN 6 55884728 missense possibly damaging 0.95
IGL02614:Ccdc129 APN 6 55968277 missense probably damaging 0.99
IGL02626:Ccdc129 APN 6 55968646 missense probably benign 0.03
IGL02674:Ccdc129 APN 6 55897928 missense probably benign 0.04
IGL02836:Ccdc129 APN 6 55898090 missense probably damaging 1.00
IGL02884:Ccdc129 APN 6 55874354 splice site probably null
IGL02889:Ccdc129 APN 6 55901458 missense possibly damaging 0.46
IGL03103:Ccdc129 APN 6 55968159 missense possibly damaging 0.59
IGL03117:Ccdc129 APN 6 55898129 missense probably benign 0.25
IGL03343:Ccdc129 APN 6 55968584 missense probably damaging 1.00
R0054:Ccdc129 UTSW 6 55872472 utr 5 prime probably benign
R0200:Ccdc129 UTSW 6 55897956 missense probably benign 0.10
R0245:Ccdc129 UTSW 6 55898007 missense probably damaging 1.00
R0320:Ccdc129 UTSW 6 55976447 missense probably damaging 1.00
R0326:Ccdc129 UTSW 6 55898243 missense possibly damaging 0.61
R0357:Ccdc129 UTSW 6 55968034 missense probably benign 0.13
R1109:Ccdc129 UTSW 6 55968260 missense probably damaging 1.00
R1118:Ccdc129 UTSW 6 55889170 missense probably damaging 1.00
R1119:Ccdc129 UTSW 6 55889170 missense probably damaging 1.00
R1462:Ccdc129 UTSW 6 55975664 missense probably damaging 1.00
R1588:Ccdc129 UTSW 6 55978503 missense possibly damaging 0.72
R1678:Ccdc129 UTSW 6 55968514 missense probably benign 0.35
R1680:Ccdc129 UTSW 6 55968766 missense probably damaging 1.00
R1728:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1729:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1737:Ccdc129 UTSW 6 55968304 missense probably damaging 1.00
R1771:Ccdc129 UTSW 6 55898147 missense probably benign 0.40
R1784:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1936:Ccdc129 UTSW 6 55897681 missense probably damaging 1.00
R1995:Ccdc129 UTSW 6 55968709 missense probably benign 0.03
R2037:Ccdc129 UTSW 6 55897875 missense probably benign 0.00
R2137:Ccdc129 UTSW 6 55889189 missense probably damaging 1.00
R2190:Ccdc129 UTSW 6 55897700 missense possibly damaging 0.87
R2191:Ccdc129 UTSW 6 55967719 missense probably benign 0.06
R2234:Ccdc129 UTSW 6 55897812 missense possibly damaging 0.67
R2235:Ccdc129 UTSW 6 55897812 missense possibly damaging 0.67
R3793:Ccdc129 UTSW 6 55975603 missense possibly damaging 0.80
R3923:Ccdc129 UTSW 6 55968060 missense probably benign 0.19
R3959:Ccdc129 UTSW 6 55897740 missense probably benign
R4332:Ccdc129 UTSW 6 55968235 missense possibly damaging 0.95
R4485:Ccdc129 UTSW 6 55887066 missense probably benign 0.00
R4688:Ccdc129 UTSW 6 55967147 splice site probably null
R4916:Ccdc129 UTSW 6 55978190 missense possibly damaging 0.77
R5201:Ccdc129 UTSW 6 55968006 missense probably benign 0.03
R5383:Ccdc129 UTSW 6 55978290 missense probably benign 0.38
R5450:Ccdc129 UTSW 6 55968811 critical splice donor site probably null
R5542:Ccdc129 UTSW 6 55978395 missense probably damaging 0.99
R5819:Ccdc129 UTSW 6 55897891 missense probably benign 0.18
R5935:Ccdc129 UTSW 6 55897769 nonsense probably null
R6034:Ccdc129 UTSW 6 55967681 missense possibly damaging 0.94
R6034:Ccdc129 UTSW 6 55967681 missense possibly damaging 0.94
R6209:Ccdc129 UTSW 6 55874321 missense probably damaging 1.00
R6246:Ccdc129 UTSW 6 55967672 missense probably damaging 1.00
R6463:Ccdc129 UTSW 6 55968678 missense probably benign 0.17
R6490:Ccdc129 UTSW 6 55976420 missense probably damaging 1.00
R6948:Ccdc129 UTSW 6 55978485 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCATCCAAGTGCCACTCAGCAG -3'
(R):5'- TGGTCTCACACTGAGAAAGCACAAC -3'

Sequencing Primer
(F):5'- AGCACTTGGGCTTCTTTGC -3'
(R):5'- CTGAGAAAGCACAACTAAGGC -3'
Posted On2014-05-09