Incidental Mutation 'R1462:Fnta'
ID186319
Institutional Source Beutler Lab
Gene Symbol Fnta
Ensembl Gene ENSMUSG00000015994
Gene Namefarnesyltransferase, CAAX box, alpha
SynonymsFTA
MMRRC Submission 039516-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.687) question?
Stock #R1462 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25998722-26015650 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 25999571 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000016138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016138]
PDB Structure
Crystal structure of FTase(ALPHA-subunit; BETA-subunit DELTA C10) in complex with BMS3 and lipid substrate FPP [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000016138
SMART Domains Protein: ENSMUSP00000016138
Gene: ENSMUSG00000015994

DomainStartEndE-ValueType
low complexity region 11 48 N/A INTRINSIC
Pfam:PPTA 116 143 4.6e-11 PFAM
Pfam:PPTA 151 178 9.2e-14 PFAM
Pfam:PPTA 185 212 3.9e-15 PFAM
Pfam:PPTA 219 246 8.1e-11 PFAM
Pfam:PPTA 259 285 4.7e-9 PFAM
low complexity region 293 304 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211718
Meta Mutation Damage Score 0.6372 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Prenyltransferases can attach either a farnesyl group or a geranylgeranyl group in thioether linkage to the cysteine residue of proteins with a C-terminal CAAX box. CAAX geranylgeranyltransferase and CAAX farnesyltransferase are heterodimers that share the same alpha subunit but have different beta subunits. This gene encodes the alpha subunit of these transferases. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 11 and 13. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C A 7: 40,992,946 S104* probably null Het
A430093F15Rik A T 19: 10,785,481 probably benign Het
Abca13 T A 11: 9,483,924 probably benign Het
Abca9 T C 11: 110,160,516 D118G probably benign Het
AC239677.1 T A 5: 25,951,625 I119F possibly damaging Het
Adamts16 A G 13: 70,836,134 F137L probably benign Het
Adamts3 T C 5: 89,861,349 I152V probably benign Het
Adcy4 T A 14: 55,778,308 E441D possibly damaging Het
Adgra1 T A 7: 139,875,829 Y458N probably damaging Het
Atpaf1 C T 4: 115,784,953 probably benign Het
Bhlhe22 C G 3: 18,055,782 S332C probably damaging Het
Card19 T A 13: 49,205,284 Q71L probably benign Het
Ccdc12 T C 9: 110,656,594 L11P probably damaging Het
Ccdc129 A G 6: 55,975,664 H864R probably damaging Het
Cdadc1 A G 14: 59,575,858 Y367H probably damaging Het
Cdc5l G T 17: 45,408,362 Q542K possibly damaging Het
Cep170 T C 1: 176,756,645 K723E possibly damaging Het
Cep70 A G 9: 99,263,720 I147V probably benign Het
Cfap58 A T 19: 47,962,430 H410L probably damaging Het
Chat T C 14: 32,420,778 K418R probably damaging Het
Cic T G 7: 25,271,607 D254E probably damaging Het
Ckap4 T C 10: 84,527,567 E544G probably damaging Het
Crnkl1 C T 2: 145,921,819 A500T probably damaging Het
Cyp2c38 T C 19: 39,392,188 N418D probably damaging Het
Daam1 A T 12: 71,944,142 I177L unknown Het
Dnah1 T C 14: 31,268,781 probably benign Het
Ercc5 A G 1: 44,180,624 T1019A probably damaging Het
F13b T A 1: 139,507,636 V173E probably damaging Het
Fam126a A G 5: 23,985,732 probably benign Het
Fam135b A G 15: 71,621,996 probably benign Het
Fam20a A C 11: 109,677,317 F316V probably damaging Het
Flrt2 T C 12: 95,779,338 V150A probably damaging Het
Ghsr A G 3: 27,371,876 D27G probably benign Het
Glis3 G T 19: 28,262,518 probably benign Het
Gm5155 T G 7: 17,915,591 noncoding transcript Het
Gtpbp1 A G 15: 79,707,885 N96D probably damaging Het
H1fnt A T 15: 98,256,573 W232R unknown Het
Ibtk A T 9: 85,724,145 I443N probably damaging Het
Ifi207 T C 1: 173,724,947 H968R probably damaging Het
Ifit2 A G 19: 34,573,186 D42G probably null Het
Il17rc A T 6: 113,478,989 D265V probably damaging Het
Ints10 G A 8: 68,807,644 probably benign Het
Itfg2 T C 6: 128,424,728 D29G probably damaging Het
Kcng3 A T 17: 83,631,063 C186S probably damaging Het
Lrrc1 A G 9: 77,442,265 F295L probably benign Het
Mrps28 T A 3: 8,900,124 H85L possibly damaging Het
Mtpn T A 6: 35,522,758 K37M possibly damaging Het
Mug1 C T 6: 121,882,629 H1196Y probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Musk A G 4: 58,286,204 probably benign Het
Mybl2 T C 2: 163,072,708 S249P probably benign Het
Naip6 A G 13: 100,300,240 Y592H possibly damaging Het
Nrp1 A G 8: 128,502,798 N919S probably benign Het
Nudt9 C T 5: 104,065,038 Q326* probably null Het
Olfr1136 A T 2: 87,693,376 C169S probably damaging Het
Olfr813 A G 10: 129,857,231 T238A probably damaging Het
Olfr827 T A 10: 130,210,723 I136F probably benign Het
Olfr829 T A 9: 18,857,111 M162K probably benign Het
Pcsk4 T C 10: 80,325,981 E142G probably damaging Het
Pde3a C A 6: 141,459,834 P471T probably benign Het
Pign A T 1: 105,585,002 V652E possibly damaging Het
Prkcb T A 7: 122,582,449 M420K probably damaging Het
Prr14 T A 7: 127,473,988 probably null Het
Rchy1 T A 5: 91,957,882 Q69L probably damaging Het
Sccpdh A C 1: 179,681,560 probably benign Het
Sec23ip T G 7: 128,766,138 S625A probably benign Het
Smpdl3b A G 4: 132,746,614 S47P probably damaging Het
Stil G A 4: 115,023,964 M568I probably benign Het
Syt3 T A 7: 44,396,010 V558E probably damaging Het
Sytl3 A G 17: 6,706,031 probably benign Het
Szt2 A G 4: 118,373,967 V2533A unknown Het
Tenm4 A G 7: 96,704,153 Y384C probably damaging Het
Tfam T C 10: 71,235,550 E94G probably damaging Het
Tmbim7 A G 5: 3,664,304 T14A probably damaging Het
Tmtc2 A T 10: 105,573,705 Y15* probably null Het
Uhrf1 C T 17: 56,318,035 A526V probably damaging Het
Vmn2r67 T C 7: 85,155,838 D22G probably benign Het
Vmn2r96 A G 17: 18,597,398 I412M possibly damaging Het
Vmn2r-ps69 T A 7: 85,310,352 noncoding transcript Het
Wdr17 A T 8: 54,670,328 I479K probably damaging Het
Wt1 T C 2: 105,166,831 V371A probably damaging Het
Zfp536 G T 7: 37,479,310 S226Y probably damaging Het
Zfp827 T C 8: 79,076,479 V560A probably benign Het
Other mutations in Fnta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fnta APN 8 26007201 nonsense probably null
IGL01508:Fnta APN 8 26007266 missense probably damaging 1.00
R0455:Fnta UTSW 8 26001028 missense probably benign 0.00
R1462:Fnta UTSW 8 25999571 splice site probably null
R1772:Fnta UTSW 8 26000966 splice site probably benign
R2095:Fnta UTSW 8 25999879 nonsense probably null
R2174:Fnta UTSW 8 26013470 missense possibly damaging 0.95
R5193:Fnta UTSW 8 26011218 splice site probably null
R5212:Fnta UTSW 8 26009707 missense probably benign 0.07
R5557:Fnta UTSW 8 25999536 missense probably damaging 1.00
R5756:Fnta UTSW 8 26009707 missense possibly damaging 0.94
R6467:Fnta UTSW 8 26007313 nonsense probably null
R7127:Fnta UTSW 8 26007203 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGACCGCTCTAACCACTCTACG -3'
(R):5'- AAGCACTAGAGGTGAGTTCCTCTCC -3'

Sequencing Primer
(F):5'- TCTACGCTCCTGCATAAGAGG -3'
(R):5'- GGTGAGTTCCTCTCCTTGTCTC -3'
Posted On2014-05-09