Incidental Mutation 'R1462:Chat'
ID186344
Institutional Source Beutler Lab
Gene Symbol Chat
Ensembl Gene ENSMUSG00000021919
Gene Namecholine acetyltransferase
SynonymsB230380D24Rik
MMRRC Submission 039516-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R1462 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location32408203-32465989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32420778 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 418 (K418R)
Ref Sequence ENSEMBL: ENSMUSP00000070865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070125]
Predicted Effect probably damaging
Transcript: ENSMUST00000070125
AA Change: K418R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070865
Gene: ENSMUSG00000021919
AA Change: K418R

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 24 612 5.5e-190 PFAM
Meta Mutation Damage Score 0.292 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which catalyzes the biosynthesis of the neurotransmitter acetylcholine. This gene product is a characteristic feature of cholinergic neurons, and changes in these neurons may explain some of the symptoms of Alzheimer's disease. Polymorphisms in this gene have been associated with Alzheimer's disease and mild cognitive impairment. Mutations in this gene are associated with congenital myasthenic syndrome associated with episodic apnea. Multiple transcript variants encoding different isoforms have been found for this gene, and some of these variants have been shown to encode more than one isoform. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutation of this gene results in hyperinnervation of motor neurons, abnormal morphology and patterning of neuromuscular synapses, and perinatal lethality. Mutant fetuses at E18.5 exhibit a hunched position, reduced body length, and carpoptosis(drop wrist). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C A 7: 40,992,946 S104* probably null Het
A430093F15Rik A T 19: 10,785,481 probably benign Het
Abca13 T A 11: 9,483,924 probably benign Het
Abca9 T C 11: 110,160,516 D118G probably benign Het
AC239677.1 T A 5: 25,951,625 I119F possibly damaging Het
Adamts16 A G 13: 70,836,134 F137L probably benign Het
Adamts3 T C 5: 89,861,349 I152V probably benign Het
Adcy4 T A 14: 55,778,308 E441D possibly damaging Het
Adgra1 T A 7: 139,875,829 Y458N probably damaging Het
Atpaf1 C T 4: 115,784,953 probably benign Het
Bhlhe22 C G 3: 18,055,782 S332C probably damaging Het
Card19 T A 13: 49,205,284 Q71L probably benign Het
Ccdc12 T C 9: 110,656,594 L11P probably damaging Het
Ccdc129 A G 6: 55,975,664 H864R probably damaging Het
Cdadc1 A G 14: 59,575,858 Y367H probably damaging Het
Cdc5l G T 17: 45,408,362 Q542K possibly damaging Het
Cep170 T C 1: 176,756,645 K723E possibly damaging Het
Cep70 A G 9: 99,263,720 I147V probably benign Het
Cfap58 A T 19: 47,962,430 H410L probably damaging Het
Cic T G 7: 25,271,607 D254E probably damaging Het
Ckap4 T C 10: 84,527,567 E544G probably damaging Het
Crnkl1 C T 2: 145,921,819 A500T probably damaging Het
Cyp2c38 T C 19: 39,392,188 N418D probably damaging Het
Daam1 A T 12: 71,944,142 I177L unknown Het
Dnah1 T C 14: 31,268,781 probably benign Het
Ercc5 A G 1: 44,180,624 T1019A probably damaging Het
F13b T A 1: 139,507,636 V173E probably damaging Het
Fam126a A G 5: 23,985,732 probably benign Het
Fam135b A G 15: 71,621,996 probably benign Het
Fam20a A C 11: 109,677,317 F316V probably damaging Het
Flrt2 T C 12: 95,779,338 V150A probably damaging Het
Fnta A C 8: 25,999,571 probably null Het
Ghsr A G 3: 27,371,876 D27G probably benign Het
Glis3 G T 19: 28,262,518 probably benign Het
Gm5155 T G 7: 17,915,591 noncoding transcript Het
Gtpbp1 A G 15: 79,707,885 N96D probably damaging Het
H1fnt A T 15: 98,256,573 W232R unknown Het
Ibtk A T 9: 85,724,145 I443N probably damaging Het
Ifi207 T C 1: 173,724,947 H968R probably damaging Het
Ifit2 A G 19: 34,573,186 D42G probably null Het
Il17rc A T 6: 113,478,989 D265V probably damaging Het
Ints10 G A 8: 68,807,644 probably benign Het
Itfg2 T C 6: 128,424,728 D29G probably damaging Het
Kcng3 A T 17: 83,631,063 C186S probably damaging Het
Lrrc1 A G 9: 77,442,265 F295L probably benign Het
Mrps28 T A 3: 8,900,124 H85L possibly damaging Het
Mtpn T A 6: 35,522,758 K37M possibly damaging Het
Mug1 C T 6: 121,882,629 H1196Y probably benign Het
Mup4 T C 4: 59,960,084 H60R possibly damaging Het
Musk A G 4: 58,286,204 probably benign Het
Mybl2 T C 2: 163,072,708 S249P probably benign Het
Naip6 A G 13: 100,300,240 Y592H possibly damaging Het
Nrp1 A G 8: 128,502,798 N919S probably benign Het
Nudt9 C T 5: 104,065,038 Q326* probably null Het
Olfr1136 A T 2: 87,693,376 C169S probably damaging Het
Olfr813 A G 10: 129,857,231 T238A probably damaging Het
Olfr827 T A 10: 130,210,723 I136F probably benign Het
Olfr829 T A 9: 18,857,111 M162K probably benign Het
Pcsk4 T C 10: 80,325,981 E142G probably damaging Het
Pde3a C A 6: 141,459,834 P471T probably benign Het
Pign A T 1: 105,585,002 V652E possibly damaging Het
Prkcb T A 7: 122,582,449 M420K probably damaging Het
Prr14 T A 7: 127,473,988 probably null Het
Rchy1 T A 5: 91,957,882 Q69L probably damaging Het
Sccpdh A C 1: 179,681,560 probably benign Het
Sec23ip T G 7: 128,766,138 S625A probably benign Het
Smpdl3b A G 4: 132,746,614 S47P probably damaging Het
Stil G A 4: 115,023,964 M568I probably benign Het
Syt3 T A 7: 44,396,010 V558E probably damaging Het
Sytl3 A G 17: 6,706,031 probably benign Het
Szt2 A G 4: 118,373,967 V2533A unknown Het
Tenm4 A G 7: 96,704,153 Y384C probably damaging Het
Tfam T C 10: 71,235,550 E94G probably damaging Het
Tmbim7 A G 5: 3,664,304 T14A probably damaging Het
Tmtc2 A T 10: 105,573,705 Y15* probably null Het
Uhrf1 C T 17: 56,318,035 A526V probably damaging Het
Vmn2r67 T C 7: 85,155,838 D22G probably benign Het
Vmn2r96 A G 17: 18,597,398 I412M possibly damaging Het
Vmn2r-ps69 T A 7: 85,310,352 noncoding transcript Het
Wdr17 A T 8: 54,670,328 I479K probably damaging Het
Wt1 T C 2: 105,166,831 V371A probably damaging Het
Zfp536 G T 7: 37,479,310 S226Y probably damaging Het
Zfp827 T C 8: 79,076,479 V560A probably benign Het
Other mutations in Chat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Chat APN 14 32449023 missense probably damaging 0.98
IGL01618:Chat APN 14 32446892 unclassified probably null
IGL02192:Chat APN 14 32423322 missense possibly damaging 0.94
IGL02418:Chat APN 14 32446949 missense possibly damaging 0.74
IGL02851:Chat APN 14 32458613 missense probably benign
IGL02966:Chat APN 14 32448946 missense probably damaging 1.00
IGL03401:Chat APN 14 32452569 missense probably damaging 1.00
R0511:Chat UTSW 14 32409019 missense probably damaging 1.00
R1462:Chat UTSW 14 32420778 missense probably damaging 1.00
R1729:Chat UTSW 14 32446795 missense probably damaging 1.00
R1782:Chat UTSW 14 32408987 missense probably damaging 1.00
R1972:Chat UTSW 14 32424191 missense probably benign 0.03
R1973:Chat UTSW 14 32424191 missense probably benign 0.03
R2061:Chat UTSW 14 32446873 missense probably benign 0.00
R2270:Chat UTSW 14 32454581 missense probably damaging 0.99
R4012:Chat UTSW 14 32423312 missense possibly damaging 0.56
R4601:Chat UTSW 14 32424155 missense probably benign 0.00
R4620:Chat UTSW 14 32453818 missense probably damaging 1.00
R4760:Chat UTSW 14 32453737 missense probably benign
R4885:Chat UTSW 14 32454610 missense probably damaging 1.00
R4899:Chat UTSW 14 32448977 missense possibly damaging 0.80
R4940:Chat UTSW 14 32419105 missense probably damaging 1.00
R4960:Chat UTSW 14 32420814 missense possibly damaging 0.86
R5094:Chat UTSW 14 32408939 missense probably damaging 1.00
R6039:Chat UTSW 14 32449027 missense probably damaging 1.00
R6039:Chat UTSW 14 32449027 missense probably damaging 1.00
R6621:Chat UTSW 14 32419013 missense probably damaging 0.97
R6648:Chat UTSW 14 32454694 missense probably benign 0.17
R6980:Chat UTSW 14 32424154 missense probably benign 0.15
R7203:Chat UTSW 14 32419057 missense probably damaging 1.00
X0014:Chat UTSW 14 32446933 missense probably benign 0.01
X0066:Chat UTSW 14 32453831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAGTCCCTCATTTGTGACACC -3'
(R):5'- GGATGATAAGGGCTATGCACTCACC -3'

Sequencing Primer
(F):5'- AGCTCGGATGGTAACATCTC -3'
(R):5'- GGGCTATGCACTCACCTTCTG -3'
Posted On2014-05-09