Incidental Mutation 'R1651:Tmx2'
ID186366
Institutional Source Beutler Lab
Gene Symbol Tmx2
Ensembl Gene ENSMUSG00000050043
Gene Namethioredoxin-related transmembrane protein 2
Synonyms2310042M24Rik, Txndc14
MMRRC Submission 039687-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.389) question?
Stock #R1651 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location84671316-84679140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84676117 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 77 (M77K)
Ref Sequence ENSEMBL: ENSMUSP00000107294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053664] [ENSMUST00000102645] [ENSMUST00000111664] [ENSMUST00000111665] [ENSMUST00000152149] [ENSMUST00000189772]
Predicted Effect probably damaging
Transcript: ENSMUST00000053664
AA Change: M77K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059582
Gene: ENSMUSG00000050043
AA Change: M77K

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
Pfam:Thioredoxin 137 243 3.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102645
SMART Domains Protein: ENSMUSP00000099705
Gene: ENSMUSG00000027080

DomainStartEndE-ValueType
low complexity region 24 55 N/A INTRINSIC
Pfam:Med19 63 234 4e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111664
AA Change: M77K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107293
Gene: ENSMUSG00000050043
AA Change: M77K

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
Pfam:Thioredoxin 99 205 1.6e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111665
AA Change: M77K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107294
Gene: ENSMUSG00000050043
AA Change: M77K

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
Pfam:Thioredoxin 137 243 3.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138529
Predicted Effect possibly damaging
Transcript: ENSMUST00000152149
AA Change: M77K

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115745
Gene: ENSMUSG00000050043
AA Change: M77K

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189772
SMART Domains Protein: ENSMUSP00000141166
Gene: ENSMUSG00000101645

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Meta Mutation Damage Score 0.402 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, one transmembrane domain and a C-terminal ER-retention sequence. This protein is enriched on the mitochondria-associated-membrane of the ER via palmitoylation of two of its cytosolically exposed cysteines. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 T A 2: 150,848,421 Q118L probably benign Het
Acss1 A T 2: 150,638,437 V238D possibly damaging Het
Adgrv1 T C 13: 81,487,853 I3512M probably benign Het
Arhgap32 A G 9: 32,259,800 Q1292R probably damaging Het
Caskin1 C T 17: 24,502,212 R509C possibly damaging Het
Cd47 T C 16: 49,894,228 V147A possibly damaging Het
Cdc20b T A 13: 113,078,724 Y275* probably null Het
Chd4 A G 6: 125,123,584 D1745G possibly damaging Het
Crmp1 T A 5: 37,273,439 S250T probably damaging Het
Crybg2 C A 4: 134,074,825 P1099T possibly damaging Het
Crybg2 A G 4: 134,074,903 K1125E probably benign Het
Csf1r T A 18: 61,110,401 I163N possibly damaging Het
Dicer1 T C 12: 104,708,805 T733A probably damaging Het
Edar A G 10: 58,606,053 V339A possibly damaging Het
Efcab6 A G 15: 83,870,993 I1374T possibly damaging Het
Erbb2 G A 11: 98,433,457 R757K probably damaging Het
Fam98a A G 17: 75,547,715 V33A probably benign Het
Farp2 T C 1: 93,603,469 probably null Het
Fcmr A G 1: 130,878,251 T315A probably benign Het
Gdf9 G A 11: 53,433,749 R115Q probably damaging Het
Gm11639 A G 11: 104,720,666 R445G probably benign Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gm428 A T 4: 73,687,384 N344I possibly damaging Het
H2-M10.1 A G 17: 36,325,756 V52A probably damaging Het
Hspg2 T A 4: 137,533,437 C1582* probably null Het
Icam2 C T 11: 106,377,956 V229M probably damaging Het
Impad1 A G 4: 4,792,737 F123L probably damaging Het
Itga7 C T 10: 128,948,824 P735L probably benign Het
Kbtbd3 C A 9: 4,330,589 P321Q possibly damaging Het
Kcnma1 T A 14: 23,314,194 T997S probably damaging Het
Kifc5b T C 17: 26,925,530 F541S probably damaging Het
Klhdc9 C A 1: 171,360,448 V72L probably benign Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lrrtm4 A G 6: 80,022,528 T308A probably benign Het
Map1b T C 13: 99,432,583 E1210G unknown Het
Mocs3 A G 2: 168,231,569 Y312C probably damaging Het
Mrps7 G T 11: 115,604,755 E40* probably null Het
Msln T C 17: 25,753,408 H50R probably benign Het
Myb A G 10: 21,126,198 F748S probably damaging Het
Myo10 C A 15: 25,742,369 H590N probably damaging Het
Naip5 T C 13: 100,221,911 E939G probably benign Het
Nbeal1 T A 1: 60,200,119 V107E probably damaging Het
Nrcam A T 12: 44,576,679 N1011I probably damaging Het
Olfr1223 A C 2: 89,145,002 V7G probably damaging Het
Olfr301 A G 7: 86,407,870 probably benign Het
Olfr356 T C 2: 36,937,323 L68P probably damaging Het
Pcgf6 A T 19: 47,049,002 C153S probably damaging Het
Phrf1 T C 7: 141,237,521 V81A probably benign Het
Ppp4r4 A G 12: 103,584,072 N36D probably benign Het
Prkch A G 12: 73,759,001 T517A possibly damaging Het
Rasal1 A T 5: 120,652,845 K33* probably null Het
Rp1l1 G A 14: 64,030,993 E1343K probably damaging Het
Serpinb6e T C 13: 33,836,423 D234G probably benign Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Smyd3 T G 1: 179,043,876 I313L probably benign Het
Tdrd9 C A 12: 112,024,706 D543E probably damaging Het
Tet1 A G 10: 62,879,674 L114P probably damaging Het
Tmprss11c G A 5: 86,239,424 P212S probably damaging Het
Traf3 T G 12: 111,262,036 D560E probably damaging Het
Trappc12 C T 12: 28,691,777 M711I probably benign Het
Trim2 A G 3: 84,167,650 probably null Het
Vmn2r18 A G 5: 151,561,999 S677P probably damaging Het
Wdr7 T A 18: 63,720,776 L60* probably null Het
Wdr93 T C 7: 79,750,082 F140L probably benign Het
Zfp638 A G 6: 83,954,737 T802A probably benign Het
Other mutations in Tmx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Tmx2 APN 2 84673299 missense probably benign
IGL02458:Tmx2 APN 2 84673244 unclassified probably benign
R0201:Tmx2 UTSW 2 84673082 missense probably benign
R0240:Tmx2 UTSW 2 84675842 missense probably damaging 1.00
R0240:Tmx2 UTSW 2 84675842 missense probably damaging 1.00
R0269:Tmx2 UTSW 2 84672396 missense probably benign 0.21
R0617:Tmx2 UTSW 2 84672396 missense probably benign 0.21
R4791:Tmx2 UTSW 2 84677996 missense probably damaging 1.00
R5793:Tmx2 UTSW 2 84676157 missense probably damaging 1.00
X0064:Tmx2 UTSW 2 84676095 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCACAGTGACTGGAACACAGAGAG -3'
(R):5'- ACCAGCCATTTGCCAAGGGTAAC -3'

Sequencing Primer
(F):5'- CAGTCAGGCTGGGCTGAAG -3'
(R):5'- AAGGGTAACCCCTTTGACTTG -3'
Posted On2014-05-09