Incidental Mutation 'R1651:Abhd12'
ID186369
Institutional Source Beutler Lab
Gene Symbol Abhd12
Ensembl Gene ENSMUSG00000032046
Gene Nameabhydrolase domain containing 12
Synonyms
MMRRC Submission 039687-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.443) question?
Stock #R1651 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location150832493-150904741 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 150848421 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 118 (Q118L)
Ref Sequence ENSEMBL: ENSMUSP00000122763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056149] [ENSMUST00000129228] [ENSMUST00000141899]
Predicted Effect probably benign
Transcript: ENSMUST00000056149
AA Change: Q118L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000053558
Gene: ENSMUSG00000032046
AA Change: Q118L

DomainStartEndE-ValueType
low complexity region 15 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Hydrolase_4 165 297 1.2e-16 PFAM
Pfam:Abhydrolase_1 169 302 1.6e-13 PFAM
Pfam:Abhydrolase_5 170 359 2.5e-22 PFAM
Pfam:Abhydrolase_6 171 363 1.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129228
SMART Domains Protein: ENSMUSP00000118501
Gene: ENSMUSG00000032046

DomainStartEndE-ValueType
low complexity region 15 36 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138608
Predicted Effect probably benign
Transcript: ENSMUST00000141899
AA Change: Q118L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000122763
Gene: ENSMUSG00000032046
AA Change: Q118L

DomainStartEndE-ValueType
low complexity region 15 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Abhydrolase_5 170 295 1.9e-16 PFAM
Pfam:Abhydrolase_6 171 293 3.8e-15 PFAM
Pfam:Abhydrolase_3 171 295 1.1e-6 PFAM
Pfam:Abhydrolase_1 198 271 1.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155119
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the hydrolysis of 2-arachidonoyl glycerol (2-AG), the main endocannabinoid lipid transmitter that acts on cannabinoid receptors, CB1 and CB2. The endocannabinoid system is involved in a wide range of physiological processes, including neurotransmission, mood, appetite, pain appreciation, addiction behavior, and inflammation. Mutations in this gene are associated with the neurodegenerative disease, PHARC (polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract), resulting from an inborn error of endocannabinoid metabolism. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neurological symptoms of neurodegeneration, hearing loss, ataxia, microgliosis and reduced brain lysophosphatidylserine lipase activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss1 A T 2: 150,638,437 V238D possibly damaging Het
Adgrv1 T C 13: 81,487,853 I3512M probably benign Het
Arhgap32 A G 9: 32,259,800 Q1292R probably damaging Het
Caskin1 C T 17: 24,502,212 R509C possibly damaging Het
Cd47 T C 16: 49,894,228 V147A possibly damaging Het
Cdc20b T A 13: 113,078,724 Y275* probably null Het
Chd4 A G 6: 125,123,584 D1745G possibly damaging Het
Crmp1 T A 5: 37,273,439 S250T probably damaging Het
Crybg2 C A 4: 134,074,825 P1099T possibly damaging Het
Crybg2 A G 4: 134,074,903 K1125E probably benign Het
Csf1r T A 18: 61,110,401 I163N possibly damaging Het
Dicer1 T C 12: 104,708,805 T733A probably damaging Het
Edar A G 10: 58,606,053 V339A possibly damaging Het
Efcab6 A G 15: 83,870,993 I1374T possibly damaging Het
Erbb2 G A 11: 98,433,457 R757K probably damaging Het
Fam98a A G 17: 75,547,715 V33A probably benign Het
Farp2 T C 1: 93,603,469 probably null Het
Fcmr A G 1: 130,878,251 T315A probably benign Het
Gdf9 G A 11: 53,433,749 R115Q probably damaging Het
Gm11639 A G 11: 104,720,666 R445G probably benign Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gm428 A T 4: 73,687,384 N344I possibly damaging Het
H2-M10.1 A G 17: 36,325,756 V52A probably damaging Het
Hspg2 T A 4: 137,533,437 C1582* probably null Het
Icam2 C T 11: 106,377,956 V229M probably damaging Het
Impad1 A G 4: 4,792,737 F123L probably damaging Het
Itga7 C T 10: 128,948,824 P735L probably benign Het
Kbtbd3 C A 9: 4,330,589 P321Q possibly damaging Het
Kcnma1 T A 14: 23,314,194 T997S probably damaging Het
Kifc5b T C 17: 26,925,530 F541S probably damaging Het
Klhdc9 C A 1: 171,360,448 V72L probably benign Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lrrtm4 A G 6: 80,022,528 T308A probably benign Het
Map1b T C 13: 99,432,583 E1210G unknown Het
Mocs3 A G 2: 168,231,569 Y312C probably damaging Het
Mrps7 G T 11: 115,604,755 E40* probably null Het
Msln T C 17: 25,753,408 H50R probably benign Het
Myb A G 10: 21,126,198 F748S probably damaging Het
Myo10 C A 15: 25,742,369 H590N probably damaging Het
Naip5 T C 13: 100,221,911 E939G probably benign Het
Nbeal1 T A 1: 60,200,119 V107E probably damaging Het
Nrcam A T 12: 44,576,679 N1011I probably damaging Het
Olfr1223 A C 2: 89,145,002 V7G probably damaging Het
Olfr301 A G 7: 86,407,870 probably benign Het
Olfr356 T C 2: 36,937,323 L68P probably damaging Het
Pcgf6 A T 19: 47,049,002 C153S probably damaging Het
Phrf1 T C 7: 141,237,521 V81A probably benign Het
Ppp4r4 A G 12: 103,584,072 N36D probably benign Het
Prkch A G 12: 73,759,001 T517A possibly damaging Het
Rasal1 A T 5: 120,652,845 K33* probably null Het
Rp1l1 G A 14: 64,030,993 E1343K probably damaging Het
Serpinb6e T C 13: 33,836,423 D234G probably benign Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Smyd3 T G 1: 179,043,876 I313L probably benign Het
Tdrd9 C A 12: 112,024,706 D543E probably damaging Het
Tet1 A G 10: 62,879,674 L114P probably damaging Het
Tmprss11c G A 5: 86,239,424 P212S probably damaging Het
Tmx2 A T 2: 84,676,117 M77K probably damaging Het
Traf3 T G 12: 111,262,036 D560E probably damaging Het
Trappc12 C T 12: 28,691,777 M711I probably benign Het
Trim2 A G 3: 84,167,650 probably null Het
Vmn2r18 A G 5: 151,561,999 S677P probably damaging Het
Wdr7 T A 18: 63,720,776 L60* probably null Het
Wdr93 T C 7: 79,750,082 F140L probably benign Het
Zfp638 A G 6: 83,954,737 T802A probably benign Het
Other mutations in Abhd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02158:Abhd12 APN 2 150848421 missense probably benign 0.00
IGL02399:Abhd12 APN 2 150858493 splice site probably benign
IGL02437:Abhd12 APN 2 150834369 missense probably benign 0.01
IGL02981:Abhd12 APN 2 150833124 missense probably benign
R0423:Abhd12 UTSW 2 150838392 missense possibly damaging 0.89
R0617:Abhd12 UTSW 2 150846365 critical splice acceptor site probably null
R0745:Abhd12 UTSW 2 150833148 splice site probably null
R1829:Abhd12 UTSW 2 150843398 missense probably damaging 1.00
R1832:Abhd12 UTSW 2 150848418 missense probably damaging 0.97
R1833:Abhd12 UTSW 2 150848418 missense probably damaging 0.97
R2298:Abhd12 UTSW 2 150901494 intron probably benign
R3153:Abhd12 UTSW 2 150834355 missense probably benign 0.21
R4077:Abhd12 UTSW 2 150848459 critical splice acceptor site probably null
R4508:Abhd12 UTSW 2 150904355 critical splice donor site probably benign
R5193:Abhd12 UTSW 2 150835306 makesense probably null
R5898:Abhd12 UTSW 2 150839778 missense possibly damaging 0.89
R6250:Abhd12 UTSW 2 150839747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAACTGAACTCACGTAGCCTCC -3'
(R):5'- GTGGCAAAATCCTGACAGCAAAGC -3'

Sequencing Primer
(F):5'- TCACGTAGCCTCCTGAAGAG -3'
(R):5'- TCACCTATGCTGTGGGAATG -3'
Posted On2014-05-09