Incidental Mutation 'R1651:Crmp1'
ID186378
Institutional Source Beutler Lab
Gene Symbol Crmp1
Ensembl Gene ENSMUSG00000029121
Gene Namecollapsin response mediator protein 1
SynonymsUlip3, DRP-1
MMRRC Submission 039687-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.392) question?
Stock #R1651 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location37241940-37292133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37273439 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 250 (S250T)
Ref Sequence ENSEMBL: ENSMUSP00000109795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031004] [ENSMUST00000114158] [ENSMUST00000201834] [ENSMUST00000202434] [ENSMUST00000202652]
Predicted Effect probably benign
Transcript: ENSMUST00000031004
AA Change: S136T

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000031004
Gene: ENSMUSG00000029121
AA Change: S136T

DomainStartEndE-ValueType
Pfam:Amidohydro_1 64 453 9.1e-35 PFAM
Pfam:Amidohydro_3 333 454 8.5e-10 PFAM
low complexity region 507 530 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114158
AA Change: S250T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109795
Gene: ENSMUSG00000029121
AA Change: S250T

DomainStartEndE-ValueType
Pfam:Amidohydro_1 178 567 5.2e-34 PFAM
Pfam:Amidohydro_3 448 568 2.8e-10 PFAM
low complexity region 621 644 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000201834
AA Change: S73T

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144408
Gene: ENSMUSG00000029121
AA Change: S73T

DomainStartEndE-ValueType
Pfam:Amidohydro_1 1 143 3.6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202377
Predicted Effect probably benign
Transcript: ENSMUST00000202434
SMART Domains Protein: ENSMUSP00000143847
Gene: ENSMUSG00000029121

DomainStartEndE-ValueType
PDB:1KCX|B 128 191 3e-36 PDB
SCOP:d1gkpa1 131 190 2e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000202652
AA Change: S73T

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143895
Gene: ENSMUSG00000029121
AA Change: S73T

DomainStartEndE-ValueType
Pfam:Amidohydro_1 1 155 1.2e-10 PFAM
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: This gene encodes a protein that is part of the collapsin response mediator protein family. The family is comprised of five, homologous cytosolic phosphoproteins that are expressed in developing and adult nervous tissue and mediate signaling to transduce responses to extracellular cues. This protein is a Semaphorin 3A signaling molecule that regulates collapse of the growth cone. The growth cone mediates axonal pathfinding in neurons. This protein is reported to represent a new class of microtubule-associated proteins. In humans this protein is reported to inhibit cancer cell invasion. In mouse deficiency of this gene may be associated with impaired spatial memory performance. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for one knock-out allele show transient postnatal changes in granule cell proliferation, apoptosis and migration in cerebellum and delayed radial migration of cortical neurons in cerebral cortex. Homozygotes for another knock-out allele show reduced LTP and impaired spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 T A 2: 150,848,421 Q118L probably benign Het
Acss1 A T 2: 150,638,437 V238D possibly damaging Het
Adgrv1 T C 13: 81,487,853 I3512M probably benign Het
Arhgap32 A G 9: 32,259,800 Q1292R probably damaging Het
Caskin1 C T 17: 24,502,212 R509C possibly damaging Het
Cd47 T C 16: 49,894,228 V147A possibly damaging Het
Cdc20b T A 13: 113,078,724 Y275* probably null Het
Chd4 A G 6: 125,123,584 D1745G possibly damaging Het
Crybg2 C A 4: 134,074,825 P1099T possibly damaging Het
Crybg2 A G 4: 134,074,903 K1125E probably benign Het
Csf1r T A 18: 61,110,401 I163N possibly damaging Het
Dicer1 T C 12: 104,708,805 T733A probably damaging Het
Edar A G 10: 58,606,053 V339A possibly damaging Het
Efcab6 A G 15: 83,870,993 I1374T possibly damaging Het
Erbb2 G A 11: 98,433,457 R757K probably damaging Het
Fam98a A G 17: 75,547,715 V33A probably benign Het
Farp2 T C 1: 93,603,469 probably null Het
Fcmr A G 1: 130,878,251 T315A probably benign Het
Gdf9 G A 11: 53,433,749 R115Q probably damaging Het
Gm11639 A G 11: 104,720,666 R445G probably benign Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gm428 A T 4: 73,687,384 N344I possibly damaging Het
H2-M10.1 A G 17: 36,325,756 V52A probably damaging Het
Hspg2 T A 4: 137,533,437 C1582* probably null Het
Icam2 C T 11: 106,377,956 V229M probably damaging Het
Impad1 A G 4: 4,792,737 F123L probably damaging Het
Itga7 C T 10: 128,948,824 P735L probably benign Het
Kbtbd3 C A 9: 4,330,589 P321Q possibly damaging Het
Kcnma1 T A 14: 23,314,194 T997S probably damaging Het
Kifc5b T C 17: 26,925,530 F541S probably damaging Het
Klhdc9 C A 1: 171,360,448 V72L probably benign Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lrrtm4 A G 6: 80,022,528 T308A probably benign Het
Map1b T C 13: 99,432,583 E1210G unknown Het
Mocs3 A G 2: 168,231,569 Y312C probably damaging Het
Mrps7 G T 11: 115,604,755 E40* probably null Het
Msln T C 17: 25,753,408 H50R probably benign Het
Myb A G 10: 21,126,198 F748S probably damaging Het
Myo10 C A 15: 25,742,369 H590N probably damaging Het
Naip5 T C 13: 100,221,911 E939G probably benign Het
Nbeal1 T A 1: 60,200,119 V107E probably damaging Het
Nrcam A T 12: 44,576,679 N1011I probably damaging Het
Olfr1223 A C 2: 89,145,002 V7G probably damaging Het
Olfr301 A G 7: 86,407,870 probably benign Het
Olfr356 T C 2: 36,937,323 L68P probably damaging Het
Pcgf6 A T 19: 47,049,002 C153S probably damaging Het
Phrf1 T C 7: 141,237,521 V81A probably benign Het
Ppp4r4 A G 12: 103,584,072 N36D probably benign Het
Prkch A G 12: 73,759,001 T517A possibly damaging Het
Rasal1 A T 5: 120,652,845 K33* probably null Het
Rp1l1 G A 14: 64,030,993 E1343K probably damaging Het
Serpinb6e T C 13: 33,836,423 D234G probably benign Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Smyd3 T G 1: 179,043,876 I313L probably benign Het
Tdrd9 C A 12: 112,024,706 D543E probably damaging Het
Tet1 A G 10: 62,879,674 L114P probably damaging Het
Tmprss11c G A 5: 86,239,424 P212S probably damaging Het
Tmx2 A T 2: 84,676,117 M77K probably damaging Het
Traf3 T G 12: 111,262,036 D560E probably damaging Het
Trappc12 C T 12: 28,691,777 M711I probably benign Het
Trim2 A G 3: 84,167,650 probably null Het
Vmn2r18 A G 5: 151,561,999 S677P probably damaging Het
Wdr7 T A 18: 63,720,776 L60* probably null Het
Wdr93 T C 7: 79,750,082 F140L probably benign Het
Zfp638 A G 6: 83,954,737 T802A probably benign Het
Other mutations in Crmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Crmp1 APN 5 37276313 missense probably damaging 0.99
IGL02506:Crmp1 APN 5 37278855 splice site probably benign
IGL02904:Crmp1 APN 5 37288918 missense possibly damaging 0.80
IGL02946:Crmp1 APN 5 37284080 missense probably damaging 1.00
IGL02981:Crmp1 APN 5 37286426 missense probably damaging 0.97
IGL03068:Crmp1 APN 5 37265289 missense possibly damaging 0.69
R0049:Crmp1 UTSW 5 37265273 missense possibly damaging 0.52
R0049:Crmp1 UTSW 5 37265273 missense possibly damaging 0.52
R0105:Crmp1 UTSW 5 37284135 missense probably damaging 1.00
R0105:Crmp1 UTSW 5 37284135 missense probably damaging 1.00
R0331:Crmp1 UTSW 5 37265313 missense possibly damaging 0.79
R1226:Crmp1 UTSW 5 37273434 missense probably damaging 1.00
R1372:Crmp1 UTSW 5 37288811 missense probably benign 0.14
R1653:Crmp1 UTSW 5 37286468 missense probably damaging 1.00
R1951:Crmp1 UTSW 5 37273355 missense possibly damaging 0.81
R1977:Crmp1 UTSW 5 37276283 missense probably damaging 1.00
R2107:Crmp1 UTSW 5 37242494 missense probably benign 0.04
R2295:Crmp1 UTSW 5 37265262 missense probably benign
R2495:Crmp1 UTSW 5 37246097 critical splice donor site probably null
R3417:Crmp1 UTSW 5 37268687 missense possibly damaging 0.48
R3788:Crmp1 UTSW 5 37284140 missense probably damaging 1.00
R4490:Crmp1 UTSW 5 37276331 missense probably damaging 0.99
R5338:Crmp1 UTSW 5 37279674 missense probably benign 0.16
R5592:Crmp1 UTSW 5 37265265 missense probably benign 0.09
R5761:Crmp1 UTSW 5 37282868 missense probably benign 0.15
R6243:Crmp1 UTSW 5 37288944 missense probably damaging 1.00
R6726:Crmp1 UTSW 5 37284064 missense probably benign 0.04
R6750:Crmp1 UTSW 5 37265322 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACTGTTGGAACATCTTGGGCTTTG -3'
(R):5'- GATTGCAACCATAGTGCCAAGTGC -3'

Sequencing Primer
(F):5'- AACATCTTGGGCTTTGAGCATC -3'
(R):5'- GGAATGCTCTCTCAAGGTTTCAAAG -3'
Posted On2014-05-09