Incidental Mutation 'R1651:Phrf1'
ID186388
Institutional Source Beutler Lab
Gene Symbol Phrf1
Ensembl Gene ENSMUSG00000038611
Gene NamePHD and ring finger domains 1
Synonyms
MMRRC Submission 039687-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R1651 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141228784-141262750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141237521 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 81 (V81A)
Ref Sequence ENSEMBL: ENSMUSP00000120759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106027] [ENSMUST00000155123]
Predicted Effect unknown
Transcript: ENSMUST00000106027
AA Change: V81A
SMART Domains Protein: ENSMUSP00000101648
Gene: ENSMUSG00000038611
AA Change: V81A

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 39 70 N/A INTRINSIC
RING 109 149 3.78e-5 SMART
C1 173 229 7.05e-2 SMART
PHD 187 233 1.77e-14 SMART
RING 188 232 3.17e0 SMART
low complexity region 332 369 N/A INTRINSIC
low complexity region 491 505 N/A INTRINSIC
low complexity region 507 522 N/A INTRINSIC
low complexity region 717 728 N/A INTRINSIC
low complexity region 831 857 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 944 955 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 999 1020 N/A INTRINSIC
low complexity region 1027 1043 N/A INTRINSIC
low complexity region 1051 1090 N/A INTRINSIC
low complexity region 1094 1151 N/A INTRINSIC
low complexity region 1160 1173 N/A INTRINSIC
low complexity region 1217 1241 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
low complexity region 1288 1306 N/A INTRINSIC
low complexity region 1308 1319 N/A INTRINSIC
low complexity region 1359 1376 N/A INTRINSIC
low complexity region 1426 1441 N/A INTRINSIC
low complexity region 1575 1592 N/A INTRINSIC
Blast:IG_like 1593 1636 4e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134057
SMART Domains Protein: ENSMUSP00000118425
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
RING 27 67 3.78e-5 SMART
C1 91 147 7.05e-2 SMART
PHD 105 151 1.77e-14 SMART
RING 106 150 3.17e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155123
AA Change: V81A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120759
Gene: ENSMUSG00000038611
AA Change: V81A

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 39 70 N/A INTRINSIC
RING 109 149 3.78e-5 SMART
Blast:C1 165 209 2e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211144
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 T A 2: 150,848,421 Q118L probably benign Het
Acss1 A T 2: 150,638,437 V238D possibly damaging Het
Adgrv1 T C 13: 81,487,853 I3512M probably benign Het
Arhgap32 A G 9: 32,259,800 Q1292R probably damaging Het
Caskin1 C T 17: 24,502,212 R509C possibly damaging Het
Cd47 T C 16: 49,894,228 V147A possibly damaging Het
Cdc20b T A 13: 113,078,724 Y275* probably null Het
Chd4 A G 6: 125,123,584 D1745G possibly damaging Het
Crmp1 T A 5: 37,273,439 S250T probably damaging Het
Crybg2 C A 4: 134,074,825 P1099T possibly damaging Het
Crybg2 A G 4: 134,074,903 K1125E probably benign Het
Csf1r T A 18: 61,110,401 I163N possibly damaging Het
Dicer1 T C 12: 104,708,805 T733A probably damaging Het
Edar A G 10: 58,606,053 V339A possibly damaging Het
Efcab6 A G 15: 83,870,993 I1374T possibly damaging Het
Erbb2 G A 11: 98,433,457 R757K probably damaging Het
Fam98a A G 17: 75,547,715 V33A probably benign Het
Farp2 T C 1: 93,603,469 probably null Het
Fcmr A G 1: 130,878,251 T315A probably benign Het
Gdf9 G A 11: 53,433,749 R115Q probably damaging Het
Gm11639 A G 11: 104,720,666 R445G probably benign Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gm428 A T 4: 73,687,384 N344I possibly damaging Het
H2-M10.1 A G 17: 36,325,756 V52A probably damaging Het
Hspg2 T A 4: 137,533,437 C1582* probably null Het
Icam2 C T 11: 106,377,956 V229M probably damaging Het
Impad1 A G 4: 4,792,737 F123L probably damaging Het
Itga7 C T 10: 128,948,824 P735L probably benign Het
Kbtbd3 C A 9: 4,330,589 P321Q possibly damaging Het
Kcnma1 T A 14: 23,314,194 T997S probably damaging Het
Kifc5b T C 17: 26,925,530 F541S probably damaging Het
Klhdc9 C A 1: 171,360,448 V72L probably benign Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lrrtm4 A G 6: 80,022,528 T308A probably benign Het
Map1b T C 13: 99,432,583 E1210G unknown Het
Mocs3 A G 2: 168,231,569 Y312C probably damaging Het
Mrps7 G T 11: 115,604,755 E40* probably null Het
Msln T C 17: 25,753,408 H50R probably benign Het
Myb A G 10: 21,126,198 F748S probably damaging Het
Myo10 C A 15: 25,742,369 H590N probably damaging Het
Naip5 T C 13: 100,221,911 E939G probably benign Het
Nbeal1 T A 1: 60,200,119 V107E probably damaging Het
Nrcam A T 12: 44,576,679 N1011I probably damaging Het
Olfr1223 A C 2: 89,145,002 V7G probably damaging Het
Olfr301 A G 7: 86,407,870 probably benign Het
Olfr356 T C 2: 36,937,323 L68P probably damaging Het
Pcgf6 A T 19: 47,049,002 C153S probably damaging Het
Ppp4r4 A G 12: 103,584,072 N36D probably benign Het
Prkch A G 12: 73,759,001 T517A possibly damaging Het
Rasal1 A T 5: 120,652,845 K33* probably null Het
Rp1l1 G A 14: 64,030,993 E1343K probably damaging Het
Serpinb6e T C 13: 33,836,423 D234G probably benign Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Smyd3 T G 1: 179,043,876 I313L probably benign Het
Tdrd9 C A 12: 112,024,706 D543E probably damaging Het
Tet1 A G 10: 62,879,674 L114P probably damaging Het
Tmprss11c G A 5: 86,239,424 P212S probably damaging Het
Tmx2 A T 2: 84,676,117 M77K probably damaging Het
Traf3 T G 12: 111,262,036 D560E probably damaging Het
Trappc12 C T 12: 28,691,777 M711I probably benign Het
Trim2 A G 3: 84,167,650 probably null Het
Vmn2r18 A G 5: 151,561,999 S677P probably damaging Het
Wdr7 T A 18: 63,720,776 L60* probably null Het
Wdr93 T C 7: 79,750,082 F140L probably benign Het
Zfp638 A G 6: 83,954,737 T802A probably benign Het
Other mutations in Phrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Phrf1 APN 7 141258877 unclassified probably benign
IGL01391:Phrf1 APN 7 141262481 missense probably damaging 1.00
IGL01472:Phrf1 APN 7 141256490 splice site probably benign
IGL01633:Phrf1 APN 7 141260500 missense probably benign 0.43
IGL01808:Phrf1 APN 7 141260966 missense probably damaging 1.00
IGL02004:Phrf1 APN 7 141260333 missense probably benign 0.39
IGL02138:Phrf1 APN 7 141259283 unclassified probably benign
IGL02678:Phrf1 APN 7 141260282 missense probably damaging 1.00
IGL03077:Phrf1 APN 7 141254968 nonsense probably null
R0036:Phrf1 UTSW 7 141261780 missense probably damaging 1.00
R0036:Phrf1 UTSW 7 141261780 missense probably damaging 1.00
R0040:Phrf1 UTSW 7 141243857 missense probably damaging 1.00
R0358:Phrf1 UTSW 7 141258304 unclassified probably benign
R0445:Phrf1 UTSW 7 141247331 utr 3 prime probably benign
R0535:Phrf1 UTSW 7 141260065 missense probably benign 0.07
R0561:Phrf1 UTSW 7 141254963 missense probably benign 0.00
R0940:Phrf1 UTSW 7 141254855 splice site probably benign
R1499:Phrf1 UTSW 7 141256651 missense probably damaging 1.00
R1511:Phrf1 UTSW 7 141259801 unclassified probably benign
R1691:Phrf1 UTSW 7 141261874 nonsense probably null
R1778:Phrf1 UTSW 7 141232456 missense probably benign 0.01
R1851:Phrf1 UTSW 7 141240918 missense probably damaging 1.00
R2239:Phrf1 UTSW 7 141237692 missense probably damaging 1.00
R2857:Phrf1 UTSW 7 141259680 unclassified probably benign
R3796:Phrf1 UTSW 7 141259918 nonsense probably null
R3797:Phrf1 UTSW 7 141259918 nonsense probably null
R3798:Phrf1 UTSW 7 141259918 nonsense probably null
R3799:Phrf1 UTSW 7 141259918 nonsense probably null
R4080:Phrf1 UTSW 7 141259720 unclassified probably benign
R4081:Phrf1 UTSW 7 141259057 unclassified probably benign
R4557:Phrf1 UTSW 7 141258929 unclassified probably benign
R5217:Phrf1 UTSW 7 141260703 missense probably damaging 1.00
R5218:Phrf1 UTSW 7 141261301 missense possibly damaging 0.94
R5276:Phrf1 UTSW 7 141259283 unclassified probably benign
R5442:Phrf1 UTSW 7 141240937 missense probably damaging 1.00
R5501:Phrf1 UTSW 7 141259921 missense possibly damaging 0.91
R5695:Phrf1 UTSW 7 141258465 unclassified probably benign
R5837:Phrf1 UTSW 7 141260061 missense probably benign 0.34
R5907:Phrf1 UTSW 7 141260540 missense possibly damaging 0.79
R5996:Phrf1 UTSW 7 141259102 unclassified probably benign
R6024:Phrf1 UTSW 7 141258985 unclassified probably benign
R6244:Phrf1 UTSW 7 141237673 missense probably damaging 1.00
R6512:Phrf1 UTSW 7 141260396 missense possibly damaging 0.88
R7016:Phrf1 UTSW 7 141237563 missense probably damaging 0.98
X0027:Phrf1 UTSW 7 141256568 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGAAGCCTGTGATAGCTCACACC -3'
(R):5'- TGGACCATTCGATGATGCAATCCAG -3'

Sequencing Primer
(F):5'- GGAGCTAGTGTAATCACTTAGCC -3'
(R):5'- TCCAGGCAGAAATAATGGGCAC -3'
Posted On2014-05-09