Incidental Mutation 'R1651:Edar'
ID186395
Institutional Source Beutler Lab
Gene Symbol Edar
Ensembl Gene ENSMUSG00000003227
Gene Nameectodysplasin-A receptor
Synonymsanhidrotic ectodysplasin receptor 1, ectodermal dysplasia receptor, ectodysplasin A1 isoform receptor (EDA-A1R), downless (dl), ED1R, ED3, ED5, EDA3
MMRRC Submission 039687-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.494) question?
Stock #R1651 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location58600789-58675654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58606053 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 339 (V339A)
Ref Sequence ENSEMBL: ENSMUSP00000003312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003312]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003312
AA Change: V339A

PolyPhen 2 Score 0.493 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000003312
Gene: ENSMUSG00000003227
AA Change: V339A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:TNFR 31 71 2e-16 BLAST
SCOP:d1jmab1 31 91 2e-3 SMART
Blast:TNFR 74 113 5e-20 BLAST
low complexity region 149 169 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
SCOP:d1ngr__ 348 430 2e-4 SMART
low complexity region 439 448 N/A INTRINSIC
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor family. The encoded transmembrane protein is a receptor for the soluble ligand ectodysplasin A, and can activate the nuclear factor-kappaB, JNK, and caspase-independent cell death pathways. It is required for the development of hair, teeth, and other ectodermal derivatives. Mutations in this gene result in autosomal dominant and recessive forms of hypohidrotic ectodermal dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce abnormalities of the hair,teeth and some exocrine glands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 T A 2: 150,848,421 Q118L probably benign Het
Acss1 A T 2: 150,638,437 V238D possibly damaging Het
Adgrv1 T C 13: 81,487,853 I3512M probably benign Het
Arhgap32 A G 9: 32,259,800 Q1292R probably damaging Het
Caskin1 C T 17: 24,502,212 R509C possibly damaging Het
Cd47 T C 16: 49,894,228 V147A possibly damaging Het
Cdc20b T A 13: 113,078,724 Y275* probably null Het
Chd4 A G 6: 125,123,584 D1745G possibly damaging Het
Crmp1 T A 5: 37,273,439 S250T probably damaging Het
Crybg2 C A 4: 134,074,825 P1099T possibly damaging Het
Crybg2 A G 4: 134,074,903 K1125E probably benign Het
Csf1r T A 18: 61,110,401 I163N possibly damaging Het
Dicer1 T C 12: 104,708,805 T733A probably damaging Het
Efcab6 A G 15: 83,870,993 I1374T possibly damaging Het
Erbb2 G A 11: 98,433,457 R757K probably damaging Het
Fam98a A G 17: 75,547,715 V33A probably benign Het
Farp2 T C 1: 93,603,469 probably null Het
Fcmr A G 1: 130,878,251 T315A probably benign Het
Gdf9 G A 11: 53,433,749 R115Q probably damaging Het
Gm11639 A G 11: 104,720,666 R445G probably benign Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gm428 A T 4: 73,687,384 N344I possibly damaging Het
H2-M10.1 A G 17: 36,325,756 V52A probably damaging Het
Hspg2 T A 4: 137,533,437 C1582* probably null Het
Icam2 C T 11: 106,377,956 V229M probably damaging Het
Impad1 A G 4: 4,792,737 F123L probably damaging Het
Itga7 C T 10: 128,948,824 P735L probably benign Het
Kbtbd3 C A 9: 4,330,589 P321Q possibly damaging Het
Kcnma1 T A 14: 23,314,194 T997S probably damaging Het
Kifc5b T C 17: 26,925,530 F541S probably damaging Het
Klhdc9 C A 1: 171,360,448 V72L probably benign Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lrrtm4 A G 6: 80,022,528 T308A probably benign Het
Map1b T C 13: 99,432,583 E1210G unknown Het
Mocs3 A G 2: 168,231,569 Y312C probably damaging Het
Mrps7 G T 11: 115,604,755 E40* probably null Het
Msln T C 17: 25,753,408 H50R probably benign Het
Myb A G 10: 21,126,198 F748S probably damaging Het
Myo10 C A 15: 25,742,369 H590N probably damaging Het
Naip5 T C 13: 100,221,911 E939G probably benign Het
Nbeal1 T A 1: 60,200,119 V107E probably damaging Het
Nrcam A T 12: 44,576,679 N1011I probably damaging Het
Olfr1223 A C 2: 89,145,002 V7G probably damaging Het
Olfr301 A G 7: 86,407,870 probably benign Het
Olfr356 T C 2: 36,937,323 L68P probably damaging Het
Pcgf6 A T 19: 47,049,002 C153S probably damaging Het
Phrf1 T C 7: 141,237,521 V81A probably benign Het
Ppp4r4 A G 12: 103,584,072 N36D probably benign Het
Prkch A G 12: 73,759,001 T517A possibly damaging Het
Rasal1 A T 5: 120,652,845 K33* probably null Het
Rp1l1 G A 14: 64,030,993 E1343K probably damaging Het
Serpinb6e T C 13: 33,836,423 D234G probably benign Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Smyd3 T G 1: 179,043,876 I313L probably benign Het
Tdrd9 C A 12: 112,024,706 D543E probably damaging Het
Tet1 A G 10: 62,879,674 L114P probably damaging Het
Tmprss11c G A 5: 86,239,424 P212S probably damaging Het
Tmx2 A T 2: 84,676,117 M77K probably damaging Het
Traf3 T G 12: 111,262,036 D560E probably damaging Het
Trappc12 C T 12: 28,691,777 M711I probably benign Het
Trim2 A G 3: 84,167,650 probably null Het
Vmn2r18 A G 5: 151,561,999 S677P probably damaging Het
Wdr7 T A 18: 63,720,776 L60* probably null Het
Wdr93 T C 7: 79,750,082 F140L probably benign Het
Zfp638 A G 6: 83,954,737 T802A probably benign Het
Other mutations in Edar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Edar APN 10 58628638 missense probably damaging 1.00
IGL01551:Edar APN 10 58606038 splice site probably benign
IGL02207:Edar APN 10 58610521 missense probably damaging 0.99
IGL02391:Edar APN 10 58628581 missense probably damaging 0.96
IGL03152:Edar APN 10 58609995 missense possibly damaging 0.88
achtung2 UTSW 10 58603163 missense probably damaging 1.00
two-tone UTSW 10 58603179 missense probably damaging 1.00
ANU23:Edar UTSW 10 58628638 missense probably damaging 1.00
R0113:Edar UTSW 10 58629449 missense probably damaging 1.00
R0413:Edar UTSW 10 58629440 missense probably benign 0.00
R0927:Edar UTSW 10 58629491 splice site probably null
R1217:Edar UTSW 10 58628631 missense probably damaging 1.00
R1458:Edar UTSW 10 58607366 missense probably benign 0.27
R3820:Edar UTSW 10 58621363 missense probably damaging 1.00
R3932:Edar UTSW 10 58610342 missense probably damaging 1.00
R4050:Edar UTSW 10 58609947 missense possibly damaging 0.74
R4911:Edar UTSW 10 58621324 missense probably benign 0.03
R4924:Edar UTSW 10 58629375 missense probably damaging 1.00
R4998:Edar UTSW 10 58606093 missense probably damaging 1.00
R5311:Edar UTSW 10 58607435 missense possibly damaging 0.68
R5314:Edar UTSW 10 58607360 missense probably benign 0.00
R5371:Edar UTSW 10 58607452 missense possibly damaging 0.64
R5566:Edar UTSW 10 58628641 missense possibly damaging 0.50
R5847:Edar UTSW 10 58603179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTGCTTCAGGCTAAACCAGAAAC -3'
(R):5'- ATCTAGGCAATGGGACCAAGCCAG -3'

Sequencing Primer
(F):5'- Tttttttttgtttaagacagagtccc -3'
(R):5'- GCACAAACGGGAAGATTTGTAGTC -3'
Posted On2014-05-09