Incidental Mutation 'R1651:Gm11639'
ID186402
Institutional Source Beutler Lab
Gene Symbol Gm11639
Ensembl Gene ENSMUSG00000040838
Gene Namepredicted gene 11639
Synonyms
MMRRC Submission 039687-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R1651 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location104685707-105117394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104720666 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 445 (R445G)
Ref Sequence ENSEMBL: ENSMUSP00000148433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148007] [ENSMUST00000212287]
Predicted Effect unknown
Transcript: ENSMUST00000148007
AA Change: R372G
SMART Domains Protein: ENSMUSP00000116040
Gene: ENSMUSG00000040838
AA Change: R372G

DomainStartEndE-ValueType
low complexity region 40 55 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
internal_repeat_4 146 233 3.42e-6 PROSPERO
internal_repeat_3 165 247 2.21e-6 PROSPERO
low complexity region 331 348 N/A INTRINSIC
internal_repeat_2 349 361 4.38e-8 PROSPERO
internal_repeat_2 371 383 4.38e-8 PROSPERO
low complexity region 385 640 N/A INTRINSIC
Pfam:EF-hand_8 677 729 8.7e-6 PFAM
low complexity region 835 842 N/A INTRINSIC
internal_repeat_1 879 1106 2.47e-14 PROSPERO
internal_repeat_4 1015 1108 3.42e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175713
Predicted Effect probably benign
Transcript: ENSMUST00000212287
AA Change: R445G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.0672 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 T A 2: 150,848,421 Q118L probably benign Het
Acss1 A T 2: 150,638,437 V238D possibly damaging Het
Adgrv1 T C 13: 81,487,853 I3512M probably benign Het
Arhgap32 A G 9: 32,259,800 Q1292R probably damaging Het
Caskin1 C T 17: 24,502,212 R509C possibly damaging Het
Cd47 T C 16: 49,894,228 V147A possibly damaging Het
Cdc20b T A 13: 113,078,724 Y275* probably null Het
Chd4 A G 6: 125,123,584 D1745G possibly damaging Het
Crmp1 T A 5: 37,273,439 S250T probably damaging Het
Crybg2 C A 4: 134,074,825 P1099T possibly damaging Het
Crybg2 A G 4: 134,074,903 K1125E probably benign Het
Csf1r T A 18: 61,110,401 I163N possibly damaging Het
Dicer1 T C 12: 104,708,805 T733A probably damaging Het
Edar A G 10: 58,606,053 V339A possibly damaging Het
Efcab6 A G 15: 83,870,993 I1374T possibly damaging Het
Erbb2 G A 11: 98,433,457 R757K probably damaging Het
Fam98a A G 17: 75,547,715 V33A probably benign Het
Farp2 T C 1: 93,603,469 probably null Het
Fcmr A G 1: 130,878,251 T315A probably benign Het
Gdf9 G A 11: 53,433,749 R115Q probably damaging Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gm428 A T 4: 73,687,384 N344I possibly damaging Het
H2-M10.1 A G 17: 36,325,756 V52A probably damaging Het
Hspg2 T A 4: 137,533,437 C1582* probably null Het
Icam2 C T 11: 106,377,956 V229M probably damaging Het
Impad1 A G 4: 4,792,737 F123L probably damaging Het
Itga7 C T 10: 128,948,824 P735L probably benign Het
Kbtbd3 C A 9: 4,330,589 P321Q possibly damaging Het
Kcnma1 T A 14: 23,314,194 T997S probably damaging Het
Kifc5b T C 17: 26,925,530 F541S probably damaging Het
Klhdc9 C A 1: 171,360,448 V72L probably benign Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lrrtm4 A G 6: 80,022,528 T308A probably benign Het
Map1b T C 13: 99,432,583 E1210G unknown Het
Mocs3 A G 2: 168,231,569 Y312C probably damaging Het
Mrps7 G T 11: 115,604,755 E40* probably null Het
Msln T C 17: 25,753,408 H50R probably benign Het
Myb A G 10: 21,126,198 F748S probably damaging Het
Myo10 C A 15: 25,742,369 H590N probably damaging Het
Naip5 T C 13: 100,221,911 E939G probably benign Het
Nbeal1 T A 1: 60,200,119 V107E probably damaging Het
Nrcam A T 12: 44,576,679 N1011I probably damaging Het
Olfr1223 A C 2: 89,145,002 V7G probably damaging Het
Olfr301 A G 7: 86,407,870 probably benign Het
Olfr356 T C 2: 36,937,323 L68P probably damaging Het
Pcgf6 A T 19: 47,049,002 C153S probably damaging Het
Phrf1 T C 7: 141,237,521 V81A probably benign Het
Ppp4r4 A G 12: 103,584,072 N36D probably benign Het
Prkch A G 12: 73,759,001 T517A possibly damaging Het
Rasal1 A T 5: 120,652,845 K33* probably null Het
Rp1l1 G A 14: 64,030,993 E1343K probably damaging Het
Serpinb6e T C 13: 33,836,423 D234G probably benign Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Smyd3 T G 1: 179,043,876 I313L probably benign Het
Tdrd9 C A 12: 112,024,706 D543E probably damaging Het
Tet1 A G 10: 62,879,674 L114P probably damaging Het
Tmprss11c G A 5: 86,239,424 P212S probably damaging Het
Tmx2 A T 2: 84,676,117 M77K probably damaging Het
Traf3 T G 12: 111,262,036 D560E probably damaging Het
Trappc12 C T 12: 28,691,777 M711I probably benign Het
Trim2 A G 3: 84,167,650 probably null Het
Vmn2r18 A G 5: 151,561,999 S677P probably damaging Het
Wdr7 T A 18: 63,720,776 L60* probably null Het
Wdr93 T C 7: 79,750,082 F140L probably benign Het
Zfp638 A G 6: 83,954,737 T802A probably benign Het
Other mutations in Gm11639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Gm11639 APN 11 105100021 missense probably damaging 1.00
IGL01308:Gm11639 APN 11 104720697 missense probably benign 0.03
IGL01483:Gm11639 APN 11 104739347 missense probably benign 0.03
IGL01695:Gm11639 APN 11 104736063 missense probably damaging 1.00
IGL01860:Gm11639 APN 11 104690921 missense probably benign 0.16
IGL01981:Gm11639 APN 11 104721432 intron probably benign
IGL01984:Gm11639 APN 11 104738308 missense probably benign 0.20
IGL02023:Gm11639 APN 11 104721432 intron probably benign
IGL02252:Gm11639 APN 11 104753927 missense possibly damaging 0.68
IGL02886:Gm11639 APN 11 105095874 missense possibly damaging 0.95
IGL03116:Gm11639 APN 11 104721533 missense probably benign 0.02
IGL03141:Gm11639 APN 11 105095870 missense probably damaging 0.99
IGL03242:Gm11639 APN 11 105106404 missense probably damaging 1.00
IGL03274:Gm11639 APN 11 104721093 missense probably benign 0.03
IGL03408:Gm11639 APN 11 104710621 missense probably benign 0.03
R0018:Gm11639 UTSW 11 104721552 critical splice donor site probably null
R0068:Gm11639 UTSW 11 104720822 missense probably benign 0.29
R0350:Gm11639 UTSW 11 104690880 missense probably benign 0.03
R0646:Gm11639 UTSW 11 104720501 missense probably benign 0.03
R0668:Gm11639 UTSW 11 104720492 missense probably benign 0.16
R0715:Gm11639 UTSW 11 104720880 missense possibly damaging 0.90
R0944:Gm11639 UTSW 11 104710730 splice site probably null
R1330:Gm11639 UTSW 11 104746290 missense possibly damaging 0.84
R1508:Gm11639 UTSW 11 104710677 missense probably benign 0.03
R1643:Gm11639 UTSW 11 104698978 missense probably benign 0.16
R1665:Gm11639 UTSW 11 104721114 missense probably benign 0.07
R1702:Gm11639 UTSW 11 104691006 missense probably benign 0.03
R1711:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1779:Gm11639 UTSW 11 104720939 missense probably benign 0.15
R1813:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1818:Gm11639 UTSW 11 104721507 missense probably benign 0.10
R1896:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1969:Gm11639 UTSW 11 104746264 missense probably damaging 1.00
R2139:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R2165:Gm11639 UTSW 11 104751862 missense possibly damaging 0.93
R2359:Gm11639 UTSW 11 104739280 missense possibly damaging 0.80
R2394:Gm11639 UTSW 11 104738295 missense probably benign 0.17
R2406:Gm11639 UTSW 11 104720631 missense probably benign 0.03
R2570:Gm11639 UTSW 11 104733664 missense probably damaging 1.00
R3795:Gm11639 UTSW 11 104733675 missense possibly damaging 0.94
R4352:Gm11639 UTSW 11 104739314 missense probably null 0.25
R4359:Gm11639 UTSW 11 104733721 splice site probably null
R4424:Gm11639 UTSW 11 104736114 critical splice donor site probably null
R4895:Gm11639 UTSW 11 104720286 missense probably benign 0.16
R4895:Gm11639 UTSW 11 104749670 missense probably damaging 1.00
R5006:Gm11639 UTSW 11 104729677 splice site probably null
R5066:Gm11639 UTSW 11 104720664 missense probably benign 0.03
R5329:Gm11639 UTSW 11 104753806 intron probably null
R5405:Gm11639 UTSW 11 104721192 missense probably benign 0.07
R5814:Gm11639 UTSW 11 104736114 critical splice donor site probably benign
R5888:Gm11639 UTSW 11 104721401 splice site probably benign
R5910:Gm11639 UTSW 11 104690934 missense probably benign 0.01
R5975:Gm11639 UTSW 11 104687549 start gained probably benign
R6019:Gm11639 UTSW 11 105042902 critical splice donor site probably null
R6028:Gm11639 UTSW 11 104769655 critical splice donor site probably null
R6048:Gm11639 UTSW 11 104944433 missense unknown
R6059:Gm11639 UTSW 11 105036769 missense probably benign 0.03
R6147:Gm11639 UTSW 11 104967740 missense unknown
R6176:Gm11639 UTSW 11 104792557 missense probably benign 0.16
R6181:Gm11639 UTSW 11 104831333 missense probably benign 0.25
R6196:Gm11639 UTSW 11 104855560 missense probably benign 0.07
R6245:Gm11639 UTSW 11 104785008 missense probably benign 0.03
R6262:Gm11639 UTSW 11 104893753 missense probably benign 0.24
R6263:Gm11639 UTSW 11 104919486 missense unknown
R6277:Gm11639 UTSW 11 105010322 missense possibly damaging 0.49
R6338:Gm11639 UTSW 11 104843208 nonsense probably null
R6355:Gm11639 UTSW 11 105005685 missense probably benign 0.29
R6356:Gm11639 UTSW 11 104893707 missense probably benign 0.19
R6365:Gm11639 UTSW 11 104924586 missense unknown
R6391:Gm11639 UTSW 11 104994317 missense possibly damaging 0.92
R6556:Gm11639 UTSW 11 105008251 missense probably null 0.03
R6604:Gm11639 UTSW 11 104698946 nonsense probably null
R6605:Gm11639 UTSW 11 104999281 splice site probably null
R6634:Gm11639 UTSW 11 104893783 missense probably benign 0.17
R6851:Gm11639 UTSW 11 105005695 missense probably benign 0.03
R6862:Gm11639 UTSW 11 104721458 nonsense probably null
R6949:Gm11639 UTSW 11 104909070 missense probably damaging 1.00
R6970:Gm11639 UTSW 11 104776356 missense probably benign 0.03
R7014:Gm11639 UTSW 11 104693422 missense probably benign 0.03
R7097:Gm11639 UTSW 11 105008961 missense not run
R7122:Gm11639 UTSW 11 105008961 missense not run
R7124:Gm11639 UTSW 11 104738274 missense not run
R7146:Gm11639 UTSW 11 104967752 missense not run
R7146:Gm11639 UTSW 11 105022938 missense not run
X0026:Gm11639 UTSW 11 104720975 missense probably benign 0.07
Z1088:Gm11639 UTSW 11 104751902 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGGATGAGGCTGAACTTAAACTCTCC -3'
(R):5'- CACTTCTATCCAGTGACTTCTTGAGGC -3'

Sequencing Primer
(F):5'- TCTCAAGTGGGATCATCAGC -3'
(R):5'- GCTTGAATCACGTCTATCCGATAAC -3'
Posted On2014-05-09