Incidental Mutation 'R1651:Dicer1'
ID186409
Institutional Source Beutler Lab
Gene Symbol Dicer1
Ensembl Gene ENSMUSG00000041415
Gene Namedicer 1, ribonuclease type III
SynonymsD12Ertd7e
MMRRC Submission 039687-MU
Accession Numbers

Ncbi RefSeq: NM_148948.2; MGI:2177178

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1651 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location104687742-104751952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104708805 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 733 (T733A)
Ref Sequence ENSEMBL: ENSMUSP00000043676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041987]
Predicted Effect probably damaging
Transcript: ENSMUST00000041987
AA Change: T733A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043676
Gene: ENSMUSG00000041415
AA Change: T733A

DomainStartEndE-ValueType
DEXDc 30 233 5.14e-24 SMART
low complexity region 403 419 N/A INTRINSIC
HELICc 449 546 3.15e-10 SMART
Pfam:Dicer_dimer 620 707 1.4e-25 PFAM
low complexity region 713 723 N/A INTRINSIC
PAZ 881 1056 1.67e-48 SMART
Blast:PAZ 1080 1129 2e-8 BLAST
RIBOc 1285 1582 1.83e-35 SMART
RIBOc 1665 1831 5.97e-49 SMART
DSRM 1834 1897 6.89e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222528
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (66/68)
MGI Phenotype Strain: 3589209; 3809262; 2681012; 3576927
Lethality: E7-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mutation of this locus results in arrest of early embryonic development. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(14) Gene trapped(11)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 T A 2: 150,848,421 Q118L probably benign Het
Acss1 A T 2: 150,638,437 V238D possibly damaging Het
Adgrv1 T C 13: 81,487,853 I3512M probably benign Het
Arhgap32 A G 9: 32,259,800 Q1292R probably damaging Het
Caskin1 C T 17: 24,502,212 R509C possibly damaging Het
Cd47 T C 16: 49,894,228 V147A possibly damaging Het
Cdc20b T A 13: 113,078,724 Y275* probably null Het
Chd4 A G 6: 125,123,584 D1745G possibly damaging Het
Crmp1 T A 5: 37,273,439 S250T probably damaging Het
Crybg2 C A 4: 134,074,825 P1099T possibly damaging Het
Crybg2 A G 4: 134,074,903 K1125E probably benign Het
Csf1r T A 18: 61,110,401 I163N possibly damaging Het
Edar A G 10: 58,606,053 V339A possibly damaging Het
Efcab6 A G 15: 83,870,993 I1374T possibly damaging Het
Erbb2 G A 11: 98,433,457 R757K probably damaging Het
Fam98a A G 17: 75,547,715 V33A probably benign Het
Farp2 T C 1: 93,603,469 probably null Het
Fcmr A G 1: 130,878,251 T315A probably benign Het
Gdf9 G A 11: 53,433,749 R115Q probably damaging Het
Gm11639 A G 11: 104,720,666 R445G probably benign Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gm428 A T 4: 73,687,384 N344I possibly damaging Het
H2-M10.1 A G 17: 36,325,756 V52A probably damaging Het
Hspg2 T A 4: 137,533,437 C1582* probably null Het
Icam2 C T 11: 106,377,956 V229M probably damaging Het
Impad1 A G 4: 4,792,737 F123L probably damaging Het
Itga7 C T 10: 128,948,824 P735L probably benign Het
Kbtbd3 C A 9: 4,330,589 P321Q possibly damaging Het
Kcnma1 T A 14: 23,314,194 T997S probably damaging Het
Kifc5b T C 17: 26,925,530 F541S probably damaging Het
Klhdc9 C A 1: 171,360,448 V72L probably benign Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lrrtm4 A G 6: 80,022,528 T308A probably benign Het
Map1b T C 13: 99,432,583 E1210G unknown Het
Mocs3 A G 2: 168,231,569 Y312C probably damaging Het
Mrps7 G T 11: 115,604,755 E40* probably null Het
Msln T C 17: 25,753,408 H50R probably benign Het
Myb A G 10: 21,126,198 F748S probably damaging Het
Myo10 C A 15: 25,742,369 H590N probably damaging Het
Naip5 T C 13: 100,221,911 E939G probably benign Het
Nbeal1 T A 1: 60,200,119 V107E probably damaging Het
Nrcam A T 12: 44,576,679 N1011I probably damaging Het
Olfr1223 A C 2: 89,145,002 V7G probably damaging Het
Olfr301 A G 7: 86,407,870 probably benign Het
Olfr356 T C 2: 36,937,323 L68P probably damaging Het
Pcgf6 A T 19: 47,049,002 C153S probably damaging Het
Phrf1 T C 7: 141,237,521 V81A probably benign Het
Ppp4r4 A G 12: 103,584,072 N36D probably benign Het
Prkch A G 12: 73,759,001 T517A possibly damaging Het
Rasal1 A T 5: 120,652,845 K33* probably null Het
Rp1l1 G A 14: 64,030,993 E1343K probably damaging Het
Serpinb6e T C 13: 33,836,423 D234G probably benign Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Smyd3 T G 1: 179,043,876 I313L probably benign Het
Tdrd9 C A 12: 112,024,706 D543E probably damaging Het
Tet1 A G 10: 62,879,674 L114P probably damaging Het
Tmprss11c G A 5: 86,239,424 P212S probably damaging Het
Tmx2 A T 2: 84,676,117 M77K probably damaging Het
Traf3 T G 12: 111,262,036 D560E probably damaging Het
Trappc12 C T 12: 28,691,777 M711I probably benign Het
Trim2 A G 3: 84,167,650 probably null Het
Vmn2r18 A G 5: 151,561,999 S677P probably damaging Het
Wdr7 T A 18: 63,720,776 L60* probably null Het
Wdr93 T C 7: 79,750,082 F140L probably benign Het
Zfp638 A G 6: 83,954,737 T802A probably benign Het
Other mutations in Dicer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Dicer1 APN 12 104696772 missense possibly damaging 0.93
IGL01061:Dicer1 APN 12 104706327 missense probably null 0.75
IGL01527:Dicer1 APN 12 104691610 nonsense probably null
IGL01597:Dicer1 APN 12 104705210 nonsense probably null
IGL01636:Dicer1 APN 12 104722241 missense probably damaging 1.00
IGL01717:Dicer1 APN 12 104702787 nonsense probably null
IGL01765:Dicer1 APN 12 104706740 missense probably damaging 1.00
IGL01871:Dicer1 APN 12 104704180 missense probably damaging 1.00
IGL02316:Dicer1 APN 12 104702553 missense probably damaging 1.00
IGL02317:Dicer1 APN 12 104697020 missense probably damaging 1.00
IGL02539:Dicer1 APN 12 104697035 missense probably damaging 0.97
IGL02544:Dicer1 APN 12 104714832 missense probably damaging 1.00
IGL02664:Dicer1 APN 12 104705129 missense probably damaging 1.00
IGL02667:Dicer1 APN 12 104714906 missense probably damaging 1.00
IGL03353:Dicer1 APN 12 104713107 missense probably damaging 1.00
IGL03377:Dicer1 APN 12 104712197 missense probably damaging 0.98
everest UTSW 12 104705128 missense probably damaging 1.00
R0032:Dicer1 UTSW 12 104704798 nonsense probably null
R0032:Dicer1 UTSW 12 104704798 nonsense probably null
R0219:Dicer1 UTSW 12 104692125 critical splice donor site probably null
R0242:Dicer1 UTSW 12 104702451 missense probably benign 0.02
R0242:Dicer1 UTSW 12 104702451 missense probably benign 0.02
R0385:Dicer1 UTSW 12 104704174 missense probably damaging 1.00
R0402:Dicer1 UTSW 12 104731064 missense probably benign 0.04
R0426:Dicer1 UTSW 12 104702542 missense probably damaging 1.00
R0453:Dicer1 UTSW 12 104702630 missense probably benign
R0502:Dicer1 UTSW 12 104705060 missense probably damaging 1.00
R0507:Dicer1 UTSW 12 104691658 missense probably damaging 1.00
R0511:Dicer1 UTSW 12 104702841 missense possibly damaging 0.95
R0523:Dicer1 UTSW 12 104702491 missense probably damaging 1.00
R0559:Dicer1 UTSW 12 104706301 missense probably damaging 1.00
R0600:Dicer1 UTSW 12 104706864 missense probably damaging 1.00
R0707:Dicer1 UTSW 12 104706885 missense probably damaging 1.00
R1225:Dicer1 UTSW 12 104691607 missense probably damaging 0.98
R1351:Dicer1 UTSW 12 104729142 missense probably damaging 0.99
R1449:Dicer1 UTSW 12 104729243 missense possibly damaging 0.85
R1575:Dicer1 UTSW 12 104721969 critical splice donor site probably null
R1642:Dicer1 UTSW 12 104713156 missense probably damaging 1.00
R1658:Dicer1 UTSW 12 104700414 missense probably benign
R1815:Dicer1 UTSW 12 104722151 missense probably damaging 1.00
R1816:Dicer1 UTSW 12 104722151 missense probably damaging 1.00
R1927:Dicer1 UTSW 12 104702884 missense possibly damaging 0.91
R2113:Dicer1 UTSW 12 104713214 missense probably damaging 1.00
R2129:Dicer1 UTSW 12 104722031 missense probably damaging 1.00
R2157:Dicer1 UTSW 12 104702949 missense probably benign 0.17
R2202:Dicer1 UTSW 12 104731038 missense probably damaging 0.98
R2203:Dicer1 UTSW 12 104731038 missense probably damaging 0.98
R2243:Dicer1 UTSW 12 104730188 missense probably damaging 0.99
R4237:Dicer1 UTSW 12 104729228 missense possibly damaging 0.48
R4419:Dicer1 UTSW 12 104705114 missense probably damaging 1.00
R4482:Dicer1 UTSW 12 104706277 missense probably damaging 1.00
R4564:Dicer1 UTSW 12 104704751 nonsense probably null
R4776:Dicer1 UTSW 12 104692446 missense probably damaging 0.99
R4834:Dicer1 UTSW 12 104696591 missense probably benign 0.44
R4904:Dicer1 UTSW 12 104713066 missense probably benign
R5202:Dicer1 UTSW 12 104694731 nonsense probably null
R5272:Dicer1 UTSW 12 104704240 missense probably damaging 1.00
R5363:Dicer1 UTSW 12 104703151 missense probably damaging 1.00
R5717:Dicer1 UTSW 12 104705128 missense probably damaging 1.00
R6381:Dicer1 UTSW 12 104696462 missense probably benign 0.00
R6479:Dicer1 UTSW 12 104696723 missense probably damaging 0.97
R6956:Dicer1 UTSW 12 104731023 missense probably damaging 1.00
X0018:Dicer1 UTSW 12 104696934 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTCAAATACAAAGGCGGCTCTG -3'
(R):5'- TGCTGAATGCATGAGTGTCACGTAG -3'

Sequencing Primer
(F):5'- TCTGGAGACGCCAGGAATC -3'
(R):5'- gctggagggcagatgaagg -3'
Posted On2014-05-09