Incidental Mutation 'R1651:Efcab6'
ID186420
Institutional Source Beutler Lab
Gene Symbol Efcab6
Ensembl Gene ENSMUSG00000022441
Gene NameEF-hand calcium binding domain 6
Synonyms4931407K02Rik, 4932408N08Rik
MMRRC Submission 039687-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.447) question?
Stock #R1651 (G1)
Quality Score186
Status Validated
Chromosome15
Chromosomal Location83866712-84065379 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83870993 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1374 (I1374T)
Ref Sequence ENSEMBL: ENSMUSP00000114909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000156187]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144169
Predicted Effect possibly damaging
Transcript: ENSMUST00000156187
AA Change: I1374T

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114909
Gene: ENSMUSG00000022441
AA Change: I1374T

DomainStartEndE-ValueType
EFh 100 128 9.33e-2 SMART
low complexity region 162 172 N/A INTRINSIC
EFh 201 229 5e-2 SMART
EFh 325 353 1.59e1 SMART
EFh 532 560 1.17e2 SMART
low complexity region 598 607 N/A INTRINSIC
EFh 659 687 8.82e1 SMART
EFh 767 795 3.71e0 SMART
low complexity region 802 816 N/A INTRINSIC
EFh 909 937 2.46e-1 SMART
low complexity region 962 977 N/A INTRINSIC
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1055 1070 N/A INTRINSIC
EFh 1090 1118 2.09e0 SMART
low complexity region 1131 1136 N/A INTRINSIC
EFh 1197 1225 2e1 SMART
Blast:EFh 1233 1261 1e-9 BLAST
EFh 1342 1370 3.48e-1 SMART
EFh 1453 1481 2.49e0 SMART
Blast:EFh 1489 1516 6e-9 BLAST
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which directly binds the oncogene DJ-1 and androgen receptor to form a ternary complex in cells. This binding protein recruits histone-deacetylase complexes in order to repress transcription activity of androgen receptor. This protein may also play a role in spermatogenesis and fertilization. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 T A 2: 150,848,421 Q118L probably benign Het
Acss1 A T 2: 150,638,437 V238D possibly damaging Het
Adgrv1 T C 13: 81,487,853 I3512M probably benign Het
Arhgap32 A G 9: 32,259,800 Q1292R probably damaging Het
Caskin1 C T 17: 24,502,212 R509C possibly damaging Het
Cd47 T C 16: 49,894,228 V147A possibly damaging Het
Cdc20b T A 13: 113,078,724 Y275* probably null Het
Chd4 A G 6: 125,123,584 D1745G possibly damaging Het
Crmp1 T A 5: 37,273,439 S250T probably damaging Het
Crybg2 C A 4: 134,074,825 P1099T possibly damaging Het
Crybg2 A G 4: 134,074,903 K1125E probably benign Het
Csf1r T A 18: 61,110,401 I163N possibly damaging Het
Dicer1 T C 12: 104,708,805 T733A probably damaging Het
Edar A G 10: 58,606,053 V339A possibly damaging Het
Erbb2 G A 11: 98,433,457 R757K probably damaging Het
Fam98a A G 17: 75,547,715 V33A probably benign Het
Farp2 T C 1: 93,603,469 probably null Het
Fcmr A G 1: 130,878,251 T315A probably benign Het
Gdf9 G A 11: 53,433,749 R115Q probably damaging Het
Gm11639 A G 11: 104,720,666 R445G probably benign Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gm428 A T 4: 73,687,384 N344I possibly damaging Het
H2-M10.1 A G 17: 36,325,756 V52A probably damaging Het
Hspg2 T A 4: 137,533,437 C1582* probably null Het
Icam2 C T 11: 106,377,956 V229M probably damaging Het
Impad1 A G 4: 4,792,737 F123L probably damaging Het
Itga7 C T 10: 128,948,824 P735L probably benign Het
Kbtbd3 C A 9: 4,330,589 P321Q possibly damaging Het
Kcnma1 T A 14: 23,314,194 T997S probably damaging Het
Kifc5b T C 17: 26,925,530 F541S probably damaging Het
Klhdc9 C A 1: 171,360,448 V72L probably benign Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lrrtm4 A G 6: 80,022,528 T308A probably benign Het
Map1b T C 13: 99,432,583 E1210G unknown Het
Mocs3 A G 2: 168,231,569 Y312C probably damaging Het
Mrps7 G T 11: 115,604,755 E40* probably null Het
Msln T C 17: 25,753,408 H50R probably benign Het
Myb A G 10: 21,126,198 F748S probably damaging Het
Myo10 C A 15: 25,742,369 H590N probably damaging Het
Naip5 T C 13: 100,221,911 E939G probably benign Het
Nbeal1 T A 1: 60,200,119 V107E probably damaging Het
Nrcam A T 12: 44,576,679 N1011I probably damaging Het
Olfr1223 A C 2: 89,145,002 V7G probably damaging Het
Olfr301 A G 7: 86,407,870 probably benign Het
Olfr356 T C 2: 36,937,323 L68P probably damaging Het
Pcgf6 A T 19: 47,049,002 C153S probably damaging Het
Phrf1 T C 7: 141,237,521 V81A probably benign Het
Ppp4r4 A G 12: 103,584,072 N36D probably benign Het
Prkch A G 12: 73,759,001 T517A possibly damaging Het
Rasal1 A T 5: 120,652,845 K33* probably null Het
Rp1l1 G A 14: 64,030,993 E1343K probably damaging Het
Serpinb6e T C 13: 33,836,423 D234G probably benign Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Smyd3 T G 1: 179,043,876 I313L probably benign Het
Tdrd9 C A 12: 112,024,706 D543E probably damaging Het
Tet1 A G 10: 62,879,674 L114P probably damaging Het
Tmprss11c G A 5: 86,239,424 P212S probably damaging Het
Tmx2 A T 2: 84,676,117 M77K probably damaging Het
Traf3 T G 12: 111,262,036 D560E probably damaging Het
Trappc12 C T 12: 28,691,777 M711I probably benign Het
Trim2 A G 3: 84,167,650 probably null Het
Vmn2r18 A G 5: 151,561,999 S677P probably damaging Het
Wdr7 T A 18: 63,720,776 L60* probably null Het
Wdr93 T C 7: 79,750,082 F140L probably benign Het
Zfp638 A G 6: 83,954,737 T802A probably benign Het
Other mutations in Efcab6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Efcab6 APN 15 84018642 missense probably benign 0.09
IGL00946:Efcab6 APN 15 84018696 missense probably benign 0.19
IGL01063:Efcab6 APN 15 84054512 start codon destroyed probably null 0.53
IGL01330:Efcab6 APN 15 84044300 missense probably benign 0.26
IGL01372:Efcab6 APN 15 84044304 missense possibly damaging 0.62
IGL01644:Efcab6 APN 15 84033072 missense probably damaging 0.97
IGL02175:Efcab6 APN 15 83896100 missense probably damaging 0.98
IGL02449:Efcab6 APN 15 84010033 missense probably benign 0.00
IGL02514:Efcab6 APN 15 84032942 missense possibly damaging 0.91
IGL02514:Efcab6 APN 15 83871311 splice site probably benign
IGL02538:Efcab6 APN 15 84054521 start gained probably benign
IGL02623:Efcab6 APN 15 83879448 missense probably damaging 0.99
IGL02735:Efcab6 APN 15 83899697 missense probably damaging 1.00
IGL03139:Efcab6 APN 15 83952221 missense probably benign 0.04
IGL03274:Efcab6 APN 15 83868249 missense probably damaging 1.00
IGL03400:Efcab6 APN 15 83867045 utr 3 prime probably benign
P0045:Efcab6 UTSW 15 83918199 missense probably damaging 1.00
R0520:Efcab6 UTSW 15 83950046 missense probably benign 0.00
R0575:Efcab6 UTSW 15 83967700 missense probably benign 0.28
R0648:Efcab6 UTSW 15 83933064 splice site probably benign
R0894:Efcab6 UTSW 15 83918292 missense probably benign 0.00
R0975:Efcab6 UTSW 15 83973331 missense probably benign 0.00
R1238:Efcab6 UTSW 15 83933137 missense probably benign 0.06
R1625:Efcab6 UTSW 15 83947638 missense probably benign
R1691:Efcab6 UTSW 15 83933206 missense probably benign 0.01
R1844:Efcab6 UTSW 15 83967621 missense possibly damaging 0.47
R1929:Efcab6 UTSW 15 83892962 splice site probably benign
R1983:Efcab6 UTSW 15 83892962 splice site probably benign
R2100:Efcab6 UTSW 15 83892967 splice site probably null
R2271:Efcab6 UTSW 15 83946999 missense probably benign
R2329:Efcab6 UTSW 15 83950048 missense possibly damaging 0.90
R3618:Efcab6 UTSW 15 83950069 missense probably benign 0.00
R3687:Efcab6 UTSW 15 83871278 nonsense probably null
R3688:Efcab6 UTSW 15 83871278 nonsense probably null
R4212:Efcab6 UTSW 15 83892863 missense probably damaging 1.00
R4223:Efcab6 UTSW 15 83867108 missense probably damaging 1.00
R4459:Efcab6 UTSW 15 83904289 missense probably damaging 1.00
R4578:Efcab6 UTSW 15 83933168 missense probably benign 0.00
R4600:Efcab6 UTSW 15 83946925 missense probably benign
R5174:Efcab6 UTSW 15 84054486 missense probably benign
R5260:Efcab6 UTSW 15 83945123 missense probably benign 0.01
R5576:Efcab6 UTSW 15 83950000 missense probably benign 0.05
R5718:Efcab6 UTSW 15 83904238 missense probably damaging 1.00
R5797:Efcab6 UTSW 15 83924277 missense possibly damaging 0.82
R6027:Efcab6 UTSW 15 83967721 missense probably benign
R6110:Efcab6 UTSW 15 83879634 missense possibly damaging 0.69
R6132:Efcab6 UTSW 15 84032972 missense probably damaging 1.00
R6166:Efcab6 UTSW 15 83896115 missense probably benign 0.01
R6228:Efcab6 UTSW 15 83967624 missense possibly damaging 0.67
R6341:Efcab6 UTSW 15 83935938 missense possibly damaging 0.65
R6445:Efcab6 UTSW 15 83868357 missense probably damaging 1.00
R6494:Efcab6 UTSW 15 84044322 critical splice acceptor site probably null
R6611:Efcab6 UTSW 15 83892835 missense possibly damaging 0.68
X0019:Efcab6 UTSW 15 83879483 missense possibly damaging 0.92
X0064:Efcab6 UTSW 15 83983493 missense probably benign 0.08
Z1088:Efcab6 UTSW 15 83955009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGAGGGATTAGGCTCTGACCAG -3'
(R):5'- TGAGACCCACCAGTTGAAAGAATGC -3'

Sequencing Primer
(F):5'- GCTCTGACCAGCAGTACTTG -3'
(R):5'- CCAGTTGAAAGAATGCTTCTGTCC -3'
Posted On2014-05-09