Incidental Mutation 'R1651:Krt84'
ID186421
Institutional Source Beutler Lab
Gene Symbol Krt84
Ensembl Gene ENSMUSG00000044294
Gene Namekeratin 84
SynonymsKrt2-3, Krt2-16, HRb-1
MMRRC Submission 039687-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R1651 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101525026-101532820 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101525963 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 523 (S523F)
Ref Sequence ENSEMBL: ENSMUSP00000023720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023720]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023720
AA Change: S523F

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023720
Gene: ENSMUSG00000044294
AA Change: S523F

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 169 3.9e-39 PFAM
Filament 172 483 4.05e-163 SMART
low complexity region 535 560 N/A INTRINSIC
low complexity region 574 602 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229893
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. All hair keratins are expressed in the hair follicle; this hair keratin is contained primarily in the filiform tongue papilla, among other hair keratins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 T A 2: 150,848,421 Q118L probably benign Het
Acss1 A T 2: 150,638,437 V238D possibly damaging Het
Adgrv1 T C 13: 81,487,853 I3512M probably benign Het
Arhgap32 A G 9: 32,259,800 Q1292R probably damaging Het
Caskin1 C T 17: 24,502,212 R509C possibly damaging Het
Cd47 T C 16: 49,894,228 V147A possibly damaging Het
Cdc20b T A 13: 113,078,724 Y275* probably null Het
Chd4 A G 6: 125,123,584 D1745G possibly damaging Het
Crmp1 T A 5: 37,273,439 S250T probably damaging Het
Crybg2 C A 4: 134,074,825 P1099T possibly damaging Het
Crybg2 A G 4: 134,074,903 K1125E probably benign Het
Csf1r T A 18: 61,110,401 I163N possibly damaging Het
Dicer1 T C 12: 104,708,805 T733A probably damaging Het
Edar A G 10: 58,606,053 V339A possibly damaging Het
Efcab6 A G 15: 83,870,993 I1374T possibly damaging Het
Erbb2 G A 11: 98,433,457 R757K probably damaging Het
Fam98a A G 17: 75,547,715 V33A probably benign Het
Farp2 T C 1: 93,603,469 probably null Het
Fcmr A G 1: 130,878,251 T315A probably benign Het
Gdf9 G A 11: 53,433,749 R115Q probably damaging Het
Gm11639 A G 11: 104,720,666 R445G probably benign Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gm428 A T 4: 73,687,384 N344I possibly damaging Het
H2-M10.1 A G 17: 36,325,756 V52A probably damaging Het
Hspg2 T A 4: 137,533,437 C1582* probably null Het
Icam2 C T 11: 106,377,956 V229M probably damaging Het
Impad1 A G 4: 4,792,737 F123L probably damaging Het
Itga7 C T 10: 128,948,824 P735L probably benign Het
Kbtbd3 C A 9: 4,330,589 P321Q possibly damaging Het
Kcnma1 T A 14: 23,314,194 T997S probably damaging Het
Kifc5b T C 17: 26,925,530 F541S probably damaging Het
Klhdc9 C A 1: 171,360,448 V72L probably benign Het
Lrrtm4 A G 6: 80,022,528 T308A probably benign Het
Map1b T C 13: 99,432,583 E1210G unknown Het
Mocs3 A G 2: 168,231,569 Y312C probably damaging Het
Mrps7 G T 11: 115,604,755 E40* probably null Het
Msln T C 17: 25,753,408 H50R probably benign Het
Myb A G 10: 21,126,198 F748S probably damaging Het
Myo10 C A 15: 25,742,369 H590N probably damaging Het
Naip5 T C 13: 100,221,911 E939G probably benign Het
Nbeal1 T A 1: 60,200,119 V107E probably damaging Het
Nrcam A T 12: 44,576,679 N1011I probably damaging Het
Olfr1223 A C 2: 89,145,002 V7G probably damaging Het
Olfr301 A G 7: 86,407,870 probably benign Het
Olfr356 T C 2: 36,937,323 L68P probably damaging Het
Pcgf6 A T 19: 47,049,002 C153S probably damaging Het
Phrf1 T C 7: 141,237,521 V81A probably benign Het
Ppp4r4 A G 12: 103,584,072 N36D probably benign Het
Prkch A G 12: 73,759,001 T517A possibly damaging Het
Rasal1 A T 5: 120,652,845 K33* probably null Het
Rp1l1 G A 14: 64,030,993 E1343K probably damaging Het
Serpinb6e T C 13: 33,836,423 D234G probably benign Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Smyd3 T G 1: 179,043,876 I313L probably benign Het
Tdrd9 C A 12: 112,024,706 D543E probably damaging Het
Tet1 A G 10: 62,879,674 L114P probably damaging Het
Tmprss11c G A 5: 86,239,424 P212S probably damaging Het
Tmx2 A T 2: 84,676,117 M77K probably damaging Het
Traf3 T G 12: 111,262,036 D560E probably damaging Het
Trappc12 C T 12: 28,691,777 M711I probably benign Het
Trim2 A G 3: 84,167,650 probably null Het
Vmn2r18 A G 5: 151,561,999 S677P probably damaging Het
Wdr7 T A 18: 63,720,776 L60* probably null Het
Wdr93 T C 7: 79,750,082 F140L probably benign Het
Zfp638 A G 6: 83,954,737 T802A probably benign Het
Other mutations in Krt84
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Krt84 APN 15 101528735 missense probably damaging 1.00
IGL00227:Krt84 APN 15 101527773 missense probably benign 0.08
IGL01352:Krt84 APN 15 101528774 missense probably damaging 1.00
IGL01523:Krt84 APN 15 101528744 missense probably damaging 1.00
IGL01797:Krt84 APN 15 101528480 missense possibly damaging 0.93
IGL01874:Krt84 APN 15 101527804 missense probably damaging 1.00
IGL02044:Krt84 APN 15 101528496 missense probably damaging 1.00
IGL02183:Krt84 APN 15 101532356 missense unknown
IGL02455:Krt84 APN 15 101525735 missense unknown
IGL03023:Krt84 APN 15 101528445 missense possibly damaging 0.74
R0102:Krt84 UTSW 15 101528703 missense probably damaging 0.99
R0102:Krt84 UTSW 15 101528703 missense probably damaging 0.99
R0103:Krt84 UTSW 15 101530236 missense probably damaging 1.00
R0423:Krt84 UTSW 15 101528720 missense probably damaging 1.00
R0704:Krt84 UTSW 15 101532677 missense probably benign 0.00
R1500:Krt84 UTSW 15 101530224 missense probably damaging 0.99
R1647:Krt84 UTSW 15 101525963 missense possibly damaging 0.95
R1650:Krt84 UTSW 15 101525963 missense possibly damaging 0.95
R1652:Krt84 UTSW 15 101525963 missense possibly damaging 0.95
R1731:Krt84 UTSW 15 101525963 missense possibly damaging 0.95
R1999:Krt84 UTSW 15 101529584 missense possibly damaging 0.76
R2106:Krt84 UTSW 15 101530866 missense probably damaging 1.00
R2150:Krt84 UTSW 15 101529584 missense possibly damaging 0.76
R2212:Krt84 UTSW 15 101532538 missense probably benign 0.01
R2397:Krt84 UTSW 15 101530254 missense probably benign 0.18
R4722:Krt84 UTSW 15 101528411 missense probably damaging 1.00
R4926:Krt84 UTSW 15 101530254 missense probably benign 0.18
R5634:Krt84 UTSW 15 101528649 missense probably benign 0.30
R5807:Krt84 UTSW 15 101530212 missense probably damaging 1.00
R5978:Krt84 UTSW 15 101530230 missense probably damaging 1.00
R6524:Krt84 UTSW 15 101532752 missense unknown
R7032:Krt84 UTSW 15 101528489 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGAATCCTTCAGGAGGACATGGGC -3'
(R):5'- ATGGGCATGAGCAAACACCCAG -3'

Sequencing Primer
(F):5'- AAGAGTGGCTGGAGATCCCTC -3'
(R):5'- CAGGGATACTACAGCATCTGTC -3'
Posted On2014-05-09