Incidental Mutation 'R1651:Gm22697+Rbm27'
ID186428
Institutional Source Beutler Lab
Gene Symbol Gm22697+Rbm27
Ensembl Gene
Gene Name
Synonyms
MMRRC Submission 039687-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.047) question?
Stock #R1651 (G1)
Quality Score217
Status Validated
Chromosome18
Chromosomal Location (GRCm38)
Type of Mutationsmall deletion (12 aa in frame mutation)
DNA Base Change (assembly) AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC to AGGTCCCGGCCCAGGCCC at 42301883 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000089540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046972] [ENSMUST00000091920]
Predicted Effect probably benign
Transcript: ENSMUST00000046972
SMART Domains Protein: ENSMUSP00000041688
Gene: ENSMUSG00000024491

DomainStartEndE-ValueType
Pfam:PWI 7 77 1.4e-10 PFAM
low complexity region 78 105 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 163 188 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 268 N/A INTRINSIC
Pfam:zf-CCCH 274 300 5.2e-7 PFAM
low complexity region 317 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
low complexity region 448 462 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
SCOP:d1l3ka2 598 638 1e-4 SMART
Blast:RRM 601 643 2e-11 BLAST
Blast:RRM_2 744 782 3e-6 BLAST
low complexity region 783 798 N/A INTRINSIC
low complexity region 853 865 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
low complexity region 945 953 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091920
SMART Domains Protein: ENSMUSP00000089540
Gene: ENSMUSG00000024491

DomainStartEndE-ValueType
Pfam:PWI 7 77 1.5e-10 PFAM
low complexity region 78 105 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 163 188 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 268 N/A INTRINSIC
Pfam:zf-CCCH 274 300 5.5e-7 PFAM
low complexity region 317 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
RRM 546 615 7.94e-3 SMART
low complexity region 623 658 N/A INTRINSIC
Blast:RRM_2 788 826 3e-6 BLAST
low complexity region 827 842 N/A INTRINSIC
low complexity region 897 909 N/A INTRINSIC
low complexity region 968 982 N/A INTRINSIC
low complexity region 989 997 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 T A 2: 150,848,421 Q118L probably benign Het
Acss1 A T 2: 150,638,437 V238D possibly damaging Het
Adgrv1 T C 13: 81,487,853 I3512M probably benign Het
Arhgap32 A G 9: 32,259,800 Q1292R probably damaging Het
Caskin1 C T 17: 24,502,212 R509C possibly damaging Het
Cd47 T C 16: 49,894,228 V147A possibly damaging Het
Cdc20b T A 13: 113,078,724 Y275* probably null Het
Chd4 A G 6: 125,123,584 D1745G possibly damaging Het
Crmp1 T A 5: 37,273,439 S250T probably damaging Het
Crybg2 C A 4: 134,074,825 P1099T possibly damaging Het
Crybg2 A G 4: 134,074,903 K1125E probably benign Het
Csf1r T A 18: 61,110,401 I163N possibly damaging Het
Dicer1 T C 12: 104,708,805 T733A probably damaging Het
Edar A G 10: 58,606,053 V339A possibly damaging Het
Efcab6 A G 15: 83,870,993 I1374T possibly damaging Het
Erbb2 G A 11: 98,433,457 R757K probably damaging Het
Fam98a A G 17: 75,547,715 V33A probably benign Het
Farp2 T C 1: 93,603,469 probably null Het
Fcmr A G 1: 130,878,251 T315A probably benign Het
Gdf9 G A 11: 53,433,749 R115Q probably damaging Het
Gm11639 A G 11: 104,720,666 R445G probably benign Het
Gm428 A T 4: 73,687,384 N344I possibly damaging Het
H2-M10.1 A G 17: 36,325,756 V52A probably damaging Het
Hspg2 T A 4: 137,533,437 C1582* probably null Het
Icam2 C T 11: 106,377,956 V229M probably damaging Het
Impad1 A G 4: 4,792,737 F123L probably damaging Het
Itga7 C T 10: 128,948,824 P735L probably benign Het
Kbtbd3 C A 9: 4,330,589 P321Q possibly damaging Het
Kcnma1 T A 14: 23,314,194 T997S probably damaging Het
Kifc5b T C 17: 26,925,530 F541S probably damaging Het
Klhdc9 C A 1: 171,360,448 V72L probably benign Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lrrtm4 A G 6: 80,022,528 T308A probably benign Het
Map1b T C 13: 99,432,583 E1210G unknown Het
Mocs3 A G 2: 168,231,569 Y312C probably damaging Het
Mrps7 G T 11: 115,604,755 E40* probably null Het
Msln T C 17: 25,753,408 H50R probably benign Het
Myb A G 10: 21,126,198 F748S probably damaging Het
Myo10 C A 15: 25,742,369 H590N probably damaging Het
Naip5 T C 13: 100,221,911 E939G probably benign Het
Nbeal1 T A 1: 60,200,119 V107E probably damaging Het
Nrcam A T 12: 44,576,679 N1011I probably damaging Het
Olfr1223 A C 2: 89,145,002 V7G probably damaging Het
Olfr301 A G 7: 86,407,870 probably benign Het
Olfr356 T C 2: 36,937,323 L68P probably damaging Het
Pcgf6 A T 19: 47,049,002 C153S probably damaging Het
Phrf1 T C 7: 141,237,521 V81A probably benign Het
Ppp4r4 A G 12: 103,584,072 N36D probably benign Het
Prkch A G 12: 73,759,001 T517A possibly damaging Het
Rasal1 A T 5: 120,652,845 K33* probably null Het
Rp1l1 G A 14: 64,030,993 E1343K probably damaging Het
Serpinb6e T C 13: 33,836,423 D234G probably benign Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Smyd3 T G 1: 179,043,876 I313L probably benign Het
Tdrd9 C A 12: 112,024,706 D543E probably damaging Het
Tet1 A G 10: 62,879,674 L114P probably damaging Het
Tmprss11c G A 5: 86,239,424 P212S probably damaging Het
Tmx2 A T 2: 84,676,117 M77K probably damaging Het
Traf3 T G 12: 111,262,036 D560E probably damaging Het
Trappc12 C T 12: 28,691,777 M711I probably benign Het
Trim2 A G 3: 84,167,650 probably null Het
Vmn2r18 A G 5: 151,561,999 S677P probably damaging Het
Wdr7 T A 18: 63,720,776 L60* probably null Het
Wdr93 T C 7: 79,750,082 F140L probably benign Het
Zfp638 A G 6: 83,954,737 T802A probably benign Het
Other mutations in Gm22697+Rbm27
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1647:Gm22697+Rbm27 UTSW 18 42301883 small deletion probably benign
R1648:Gm22697+Rbm27 UTSW 18 42301883 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGAATACTCTTGCCTCTACTTCAAGGCT -3'
(R):5'- GGGACGGGGTTCTTCTAAATACAACTCA -3'

Sequencing Primer
(F):5'- GCCTCTACTTCAAGGCTATGTG -3'
(R):5'- TACAACTCATCAACAAAACAAGATTC -3'
Posted On2014-05-09