Incidental Mutation 'R1657:Qsox2'
ID186436
Institutional Source Beutler Lab
Gene Symbol Qsox2
Ensembl Gene ENSMUSG00000036327
Gene Namequiescin Q6 sulfhydryl oxidase 2
SynonymsQSOX2, Qscn6l1
MMRRC Submission 039693-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R1657 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26208637-26237525 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 26220747 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 152 (Y152*)
Ref Sequence ENSEMBL: ENSMUSP00000088807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036187] [ENSMUST00000091263]
Predicted Effect probably null
Transcript: ENSMUST00000036187
AA Change: Y317*
SMART Domains Protein: ENSMUSP00000037128
Gene: ENSMUSG00000036327
AA Change: Y317*

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Thioredoxin 59 166 1.7e-15 PFAM
low complexity region 295 310 N/A INTRINSIC
Blast:HOX 355 398 6e-14 BLAST
Pfam:Evr1_Alr 424 525 3.4e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000091263
AA Change: Y152*
SMART Domains Protein: ENSMUSP00000088807
Gene: ENSMUSG00000036327
AA Change: Y152*

DomainStartEndE-ValueType
low complexity region 130 145 N/A INTRINSIC
Blast:HOX 190 233 1e-13 BLAST
Pfam:Evr1_Alr 259 361 2.4e-30 PFAM
transmembrane domain 490 512 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the sulfhydryl oxidase protein family. Members of this family catalyze formation of disulfide bonds. A similar protein in humans may sensitize neuroblastoma cells to interferon gamma-induced cell death. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,678 Q131R probably benign Het
3632451O06Rik G C 14: 49,773,560 T230S probably damaging Het
Acaca T G 11: 84,264,084 D988E probably benign Het
Als2 A G 1: 59,180,601 V1185A probably damaging Het
Amdhd2 A G 17: 24,156,055 V391A probably damaging Het
Caprin1 A T 2: 103,769,506 V608E probably damaging Het
Celsr3 T A 9: 108,842,952 C2512* probably null Het
Cfl1 A T 19: 5,493,555 R187W probably damaging Het
Cgnl1 C T 9: 71,725,944 V42I probably damaging Het
Chd2 A G 7: 73,480,430 Y826H probably damaging Het
Col9a2 C A 4: 121,040,974 P28T unknown Het
Cyp3a44 G A 5: 145,779,743 P346S probably damaging Het
Dact2 A G 17: 14,197,990 V151A probably benign Het
Dhx29 T C 13: 112,952,843 I716T probably damaging Het
Esam T C 9: 37,537,621 S342P probably damaging Het
Fam189a2 C A 19: 23,975,635 C437F probably damaging Het
Fer1l4 A G 2: 156,035,598 V1053A possibly damaging Het
Grk3 A G 5: 112,966,982 F124S probably damaging Het
H2-DMa G A 17: 34,137,399 probably null Het
Hsd3b5 T A 3: 98,619,720 I137F possibly damaging Het
Itgav A T 2: 83,801,779 I902F probably benign Het
Itsn1 G T 16: 91,909,223 C179F probably damaging Het
Kcnh8 G A 17: 52,839,125 R347H probably damaging Het
Kif9 T C 9: 110,489,966 M166T possibly damaging Het
Kmt5c C T 7: 4,746,454 Q324* probably null Het
Lcn9 G A 2: 25,824,710 E154K probably benign Het
Mfge8 A T 7: 79,141,773 L227Q probably benign Het
Mroh2b A T 15: 4,931,043 R753* probably null Het
Mtif2 G A 11: 29,540,721 R475Q probably benign Het
Nln C T 13: 104,036,947 V584I possibly damaging Het
Nr2e3 T C 9: 59,948,767 E129G probably benign Het
Ocstamp T C 2: 165,397,516 D250G probably damaging Het
Olfr1065 A C 2: 86,445,218 L255V probably damaging Het
Olfr403 A T 11: 74,195,896 H131L probably damaging Het
Olfr503 T C 7: 108,545,377 I284T possibly damaging Het
Pld1 A T 3: 28,071,187 I417L probably benign Het
Polr1a A T 6: 71,941,535 K692N probably damaging Het
Rpap1 T C 2: 119,783,778 D46G possibly damaging Het
Rpe65 A G 3: 159,614,448 T246A probably damaging Het
Scn5a T C 9: 119,562,380 D82G probably damaging Het
Sema3d A G 5: 12,584,974 E669G possibly damaging Het
Serpinb6c T C 13: 33,880,226 N282S probably benign Het
Snap47 A T 11: 59,428,770 S181T probably benign Het
Snx9 A C 17: 5,918,436 T336P possibly damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Terb1 A T 8: 104,488,491 D284E possibly damaging Het
Tmem266 C T 9: 55,418,008 A153V probably damaging Het
Ttn T C 2: 76,742,804 E25915G possibly damaging Het
Tubal3 A G 13: 3,933,011 T264A possibly damaging Het
Vldlr G A 19: 27,245,670 R747Q probably benign Het
Zc3h8 G T 2: 128,929,957 probably benign Het
Zfp184 C T 13: 21,959,273 T383M probably damaging Het
Zfp455 T C 13: 67,198,639 F38S possibly damaging Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp985 T A 4: 147,584,110 N478K probably benign Het
Other mutations in Qsox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Qsox2 APN 2 26222255 missense probably benign 0.15
IGL01067:Qsox2 APN 2 26228396 missense probably damaging 1.00
IGL01105:Qsox2 APN 2 26209685 missense probably benign 0.00
IGL02420:Qsox2 APN 2 26220719 missense probably benign 0.07
IGL03323:Qsox2 APN 2 26220979 missense probably benign
PIT4377001:Qsox2 UTSW 2 26220912 missense probably damaging 0.99
PIT4677001:Qsox2 UTSW 2 26222308 missense probably damaging 1.00
PIT4687001:Qsox2 UTSW 2 26222288 missense possibly damaging 0.93
R0559:Qsox2 UTSW 2 26214157 missense probably benign 0.05
R0594:Qsox2 UTSW 2 26214044 missense probably damaging 1.00
R1055:Qsox2 UTSW 2 26214125 missense probably damaging 1.00
R1727:Qsox2 UTSW 2 26220958 missense probably benign 0.00
R1746:Qsox2 UTSW 2 26220638 missense probably benign
R1858:Qsox2 UTSW 2 26214062 missense probably damaging 1.00
R2309:Qsox2 UTSW 2 26228433 missense possibly damaging 0.61
R5291:Qsox2 UTSW 2 26217698 missense probably damaging 1.00
R5298:Qsox2 UTSW 2 26214062 missense probably damaging 0.96
R5524:Qsox2 UTSW 2 26217687 missense probably damaging 1.00
R5567:Qsox2 UTSW 2 26225218 start codon destroyed probably null
R5570:Qsox2 UTSW 2 26225218 start codon destroyed probably null
R5965:Qsox2 UTSW 2 26222221 missense probably benign 0.06
R6529:Qsox2 UTSW 2 26217741 missense probably damaging 1.00
R6957:Qsox2 UTSW 2 26217642 missense probably benign 0.40
R7185:Qsox2 UTSW 2 26220706 missense possibly damaging 0.63
R7250:Qsox2 UTSW 2 26228432 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACCAGTCACTACCAGGTGGTCC -3'
(R):5'- CCTTTCACAGTGCAAAGCCTCTACG -3'

Sequencing Primer
(F):5'- GCAGACAGATGATCCTAGCTC -3'
(R):5'- TTCTTGCCTGAAAAGTCCAAC -3'
Posted On2014-05-09