Incidental Mutation 'R1657:Olfr1065'
ID186441
Institutional Source Beutler Lab
Gene Symbol Olfr1065
Ensembl Gene ENSMUSG00000111306
Gene Nameolfactory receptor 1065
SynonymsMOR190-1, GA_x6K02T2Q125-47915274-47914333
MMRRC Submission 039693-MU
Accession Numbers

Genbank: NM_146408; MGI: 3030899

Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R1657 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86443958-86450591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 86445218 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 255 (L255V)
Ref Sequence ENSEMBL: ENSMUSP00000149248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000213789] [ENSMUST00000216162] [ENSMUST00000216165] [ENSMUST00000217586]
Predicted Effect probably damaging
Transcript: ENSMUST00000099886
AA Change: L255V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097471
Gene: ENSMUSG00000075182
AA Change: L255V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.1e-53 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213789
AA Change: L255V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216162
AA Change: L255V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216165
AA Change: L255V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000217586
AA Change: L255V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,678 Q131R probably benign Het
3632451O06Rik G C 14: 49,773,560 T230S probably damaging Het
Acaca T G 11: 84,264,084 D988E probably benign Het
Als2 A G 1: 59,180,601 V1185A probably damaging Het
Amdhd2 A G 17: 24,156,055 V391A probably damaging Het
Caprin1 A T 2: 103,769,506 V608E probably damaging Het
Celsr3 T A 9: 108,842,952 C2512* probably null Het
Cfl1 A T 19: 5,493,555 R187W probably damaging Het
Cgnl1 C T 9: 71,725,944 V42I probably damaging Het
Chd2 A G 7: 73,480,430 Y826H probably damaging Het
Col9a2 C A 4: 121,040,974 P28T unknown Het
Cyp3a44 G A 5: 145,779,743 P346S probably damaging Het
Dact2 A G 17: 14,197,990 V151A probably benign Het
Dhx29 T C 13: 112,952,843 I716T probably damaging Het
Esam T C 9: 37,537,621 S342P probably damaging Het
Fam189a2 C A 19: 23,975,635 C437F probably damaging Het
Fer1l4 A G 2: 156,035,598 V1053A possibly damaging Het
Grk3 A G 5: 112,966,982 F124S probably damaging Het
H2-DMa G A 17: 34,137,399 probably null Het
Hsd3b5 T A 3: 98,619,720 I137F possibly damaging Het
Itgav A T 2: 83,801,779 I902F probably benign Het
Itsn1 G T 16: 91,909,223 C179F probably damaging Het
Kcnh8 G A 17: 52,839,125 R347H probably damaging Het
Kif9 T C 9: 110,489,966 M166T possibly damaging Het
Kmt5c C T 7: 4,746,454 Q324* probably null Het
Lcn9 G A 2: 25,824,710 E154K probably benign Het
Mfge8 A T 7: 79,141,773 L227Q probably benign Het
Mroh2b A T 15: 4,931,043 R753* probably null Het
Mtif2 G A 11: 29,540,721 R475Q probably benign Het
Nln C T 13: 104,036,947 V584I possibly damaging Het
Nr2e3 T C 9: 59,948,767 E129G probably benign Het
Ocstamp T C 2: 165,397,516 D250G probably damaging Het
Olfr403 A T 11: 74,195,896 H131L probably damaging Het
Olfr503 T C 7: 108,545,377 I284T possibly damaging Het
Pld1 A T 3: 28,071,187 I417L probably benign Het
Polr1a A T 6: 71,941,535 K692N probably damaging Het
Qsox2 A T 2: 26,220,747 Y152* probably null Het
Rpap1 T C 2: 119,783,778 D46G possibly damaging Het
Rpe65 A G 3: 159,614,448 T246A probably damaging Het
Scn5a T C 9: 119,562,380 D82G probably damaging Het
Sema3d A G 5: 12,584,974 E669G possibly damaging Het
Serpinb6c T C 13: 33,880,226 N282S probably benign Het
Snap47 A T 11: 59,428,770 S181T probably benign Het
Snx9 A C 17: 5,918,436 T336P possibly damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Terb1 A T 8: 104,488,491 D284E possibly damaging Het
Tmem266 C T 9: 55,418,008 A153V probably damaging Het
Ttn T C 2: 76,742,804 E25915G possibly damaging Het
Tubal3 A G 13: 3,933,011 T264A possibly damaging Het
Vldlr G A 19: 27,245,670 R747Q probably benign Het
Zc3h8 G T 2: 128,929,957 probably benign Het
Zfp184 C T 13: 21,959,273 T383M probably damaging Het
Zfp455 T C 13: 67,198,639 F38S possibly damaging Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp985 T A 4: 147,584,110 N478K probably benign Het
Other mutations in Olfr1065
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03133:Olfr1065 APN 2 86445658 missense probably damaging 0.99
IGL03173:Olfr1065 APN 2 86445444 nonsense probably null
IGL03257:Olfr1065 APN 2 86445890 missense probably damaging 0.98
D4043:Olfr1065 UTSW 2 86445220 missense probably damaging 0.99
R0265:Olfr1065 UTSW 2 86445959 missense probably benign 0.00
R0550:Olfr1065 UTSW 2 86445876 nonsense probably null
R0633:Olfr1065 UTSW 2 86445129 missense probably benign 0.45
R0727:Olfr1065 UTSW 2 86445938 missense probably benign 0.00
R1017:Olfr1065 UTSW 2 86445428 missense probably benign 0.13
R1416:Olfr1065 UTSW 2 86445320 missense probably benign 0.43
R1983:Olfr1065 UTSW 2 86445076 missense probably benign 0.01
R3919:Olfr1065 UTSW 2 86445418 missense probably benign 0.01
R4345:Olfr1065 UTSW 2 86445845 missense probably damaging 1.00
R5382:Olfr1065 UTSW 2 86445316 missense probably damaging 0.99
R5757:Olfr1065 UTSW 2 86445578 missense probably benign 0.22
R6530:Olfr1065 UTSW 2 86445482 missense probably benign 0.31
R6765:Olfr1065 UTSW 2 86445236 missense probably benign 0.04
R6856:Olfr1065 UTSW 2 86445907 missense probably benign 0.04
R7156:Olfr1065 UTSW 2 86445308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTGTGGATTTCAAAAGCAAACACT -3'
(R):5'- TCAACAACTGTGGGACCCAAAATGTTA -3'

Sequencing Primer
(F):5'- CTGTGTAGTTTTTTCCCTGTCC -3'
(R):5'- GCAATGTCCTATGACCGCTATG -3'
Posted On2014-05-09