Incidental Mutation 'R1657:Rpap1'
ID186443
Institutional Source Beutler Lab
Gene Symbol Rpap1
Ensembl Gene ENSMUSG00000034032
Gene NameRNA polymerase II associated protein 1
Synonyms
MMRRC Submission 039693-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.973) question?
Stock #R1657 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location119763304-119787537 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119783778 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 46 (D46G)
Ref Sequence ENSEMBL: ENSMUSP00000138619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048493] [ENSMUST00000099529] [ENSMUST00000110793] [ENSMUST00000136419] [ENSMUST00000184294]
Predicted Effect probably benign
Transcript: ENSMUST00000048493
AA Change: D46G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000037275
Gene: ENSMUSG00000034032
AA Change: D46G

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 225 270 2.4e-21 PFAM
Pfam:RPAP1_C 372 438 1.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099529
AA Change: D46G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000097127
Gene: ENSMUSG00000034032
AA Change: D46G

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 1.7e-21 PFAM
Pfam:RPAP1_C 370 440 2.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110793
AA Change: D46G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106420
Gene: ENSMUSG00000034032
AA Change: D46G

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 1.7e-21 PFAM
Pfam:RPAP1_C 370 440 2.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133146
Predicted Effect possibly damaging
Transcript: ENSMUST00000136419
AA Change: D46G

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138619
Gene: ENSMUSG00000034032
AA Change: D46G

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156506
Predicted Effect probably benign
Transcript: ENSMUST00000184294
AA Change: D46G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000138873
Gene: ENSMUSG00000034032
AA Change: D46G

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 4.8e-22 PFAM
Pfam:RPAP1_C 370 440 1.2e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein forms part of the RNA polymerase II (RNAPII) enzyme complex and may recruit RNAPII to chromatin through its interaction with acetylated histones. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,678 Q131R probably benign Het
3632451O06Rik G C 14: 49,773,560 T230S probably damaging Het
Acaca T G 11: 84,264,084 D988E probably benign Het
Als2 A G 1: 59,180,601 V1185A probably damaging Het
Amdhd2 A G 17: 24,156,055 V391A probably damaging Het
Caprin1 A T 2: 103,769,506 V608E probably damaging Het
Celsr3 T A 9: 108,842,952 C2512* probably null Het
Cfl1 A T 19: 5,493,555 R187W probably damaging Het
Cgnl1 C T 9: 71,725,944 V42I probably damaging Het
Chd2 A G 7: 73,480,430 Y826H probably damaging Het
Col9a2 C A 4: 121,040,974 P28T unknown Het
Cyp3a44 G A 5: 145,779,743 P346S probably damaging Het
Dact2 A G 17: 14,197,990 V151A probably benign Het
Dhx29 T C 13: 112,952,843 I716T probably damaging Het
Esam T C 9: 37,537,621 S342P probably damaging Het
Fam189a2 C A 19: 23,975,635 C437F probably damaging Het
Fer1l4 A G 2: 156,035,598 V1053A possibly damaging Het
Grk3 A G 5: 112,966,982 F124S probably damaging Het
H2-DMa G A 17: 34,137,399 probably null Het
Hsd3b5 T A 3: 98,619,720 I137F possibly damaging Het
Itgav A T 2: 83,801,779 I902F probably benign Het
Itsn1 G T 16: 91,909,223 C179F probably damaging Het
Kcnh8 G A 17: 52,839,125 R347H probably damaging Het
Kif9 T C 9: 110,489,966 M166T possibly damaging Het
Kmt5c C T 7: 4,746,454 Q324* probably null Het
Lcn9 G A 2: 25,824,710 E154K probably benign Het
Mfge8 A T 7: 79,141,773 L227Q probably benign Het
Mroh2b A T 15: 4,931,043 R753* probably null Het
Mtif2 G A 11: 29,540,721 R475Q probably benign Het
Nln C T 13: 104,036,947 V584I possibly damaging Het
Nr2e3 T C 9: 59,948,767 E129G probably benign Het
Ocstamp T C 2: 165,397,516 D250G probably damaging Het
Olfr1065 A C 2: 86,445,218 L255V probably damaging Het
Olfr403 A T 11: 74,195,896 H131L probably damaging Het
Olfr503 T C 7: 108,545,377 I284T possibly damaging Het
Pld1 A T 3: 28,071,187 I417L probably benign Het
Polr1a A T 6: 71,941,535 K692N probably damaging Het
Qsox2 A T 2: 26,220,747 Y152* probably null Het
Rpe65 A G 3: 159,614,448 T246A probably damaging Het
Scn5a T C 9: 119,562,380 D82G probably damaging Het
Sema3d A G 5: 12,584,974 E669G possibly damaging Het
Serpinb6c T C 13: 33,880,226 N282S probably benign Het
Snap47 A T 11: 59,428,770 S181T probably benign Het
Snx9 A C 17: 5,918,436 T336P possibly damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Terb1 A T 8: 104,488,491 D284E possibly damaging Het
Tmem266 C T 9: 55,418,008 A153V probably damaging Het
Ttn T C 2: 76,742,804 E25915G possibly damaging Het
Tubal3 A G 13: 3,933,011 T264A possibly damaging Het
Vldlr G A 19: 27,245,670 R747Q probably benign Het
Zc3h8 G T 2: 128,929,957 probably benign Het
Zfp184 C T 13: 21,959,273 T383M probably damaging Het
Zfp455 T C 13: 67,198,639 F38S possibly damaging Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp985 T A 4: 147,584,110 N478K probably benign Het
Other mutations in Rpap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01807:Rpap1 APN 2 119782708 missense possibly damaging 0.50
IGL02009:Rpap1 APN 2 119780113 missense possibly damaging 0.51
IGL02068:Rpap1 APN 2 119782654 missense probably benign 0.02
IGL02100:Rpap1 APN 2 119769326 missense probably benign 0.06
IGL02528:Rpap1 APN 2 119774950 splice site probably null
IGL02530:Rpap1 APN 2 119783239 splice site probably benign
IGL02747:Rpap1 APN 2 119774128 missense probably damaging 0.98
IGL03371:Rpap1 APN 2 119775057 splice site probably benign
R0138:Rpap1 UTSW 2 119764899 unclassified probably null
R0325:Rpap1 UTSW 2 119771840 missense probably benign
R0616:Rpap1 UTSW 2 119778120 missense probably damaging 1.00
R1081:Rpap1 UTSW 2 119771269 missense probably damaging 1.00
R1837:Rpap1 UTSW 2 119769885 critical splice donor site probably null
R2307:Rpap1 UTSW 2 119783766 missense probably benign 0.00
R2308:Rpap1 UTSW 2 119783766 missense probably benign 0.00
R2375:Rpap1 UTSW 2 119770407 missense possibly damaging 0.50
R2507:Rpap1 UTSW 2 119780054 critical splice donor site probably null
R2508:Rpap1 UTSW 2 119780054 critical splice donor site probably null
R4155:Rpap1 UTSW 2 119774179 missense probably damaging 1.00
R4156:Rpap1 UTSW 2 119774179 missense probably damaging 1.00
R4157:Rpap1 UTSW 2 119774179 missense probably damaging 1.00
R4657:Rpap1 UTSW 2 119775006 missense probably benign 0.03
R4837:Rpap1 UTSW 2 119778251 missense probably benign 0.32
R4880:Rpap1 UTSW 2 119783865 missense probably damaging 0.97
R5010:Rpap1 UTSW 2 119770041 missense probably benign
R5111:Rpap1 UTSW 2 119771247 missense probably damaging 1.00
R5650:Rpap1 UTSW 2 119773850 missense probably benign
R6144:Rpap1 UTSW 2 119772647 nonsense probably null
R6353:Rpap1 UTSW 2 119776896 splice site probably null
R6646:Rpap1 UTSW 2 119780131 missense probably benign 0.03
R6731:Rpap1 UTSW 2 119778296 missense probably benign
R6872:Rpap1 UTSW 2 119775369 missense probably damaging 1.00
R6878:Rpap1 UTSW 2 119778176 missense probably damaging 1.00
R7060:Rpap1 UTSW 2 119773562 missense probably damaging 1.00
X0028:Rpap1 UTSW 2 119771062 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGTCTTCATCGTGAGGCAGC -3'
(R):5'- GTACAAAGGGCACAGCTCCAGG -3'

Sequencing Primer
(F):5'- ctctctctctctctctctctctc -3'
(R):5'- AGCTCCAGGGCCATGATG -3'
Posted On2014-05-09