Incidental Mutation 'R1657:Pld1'
ID186448
Institutional Source Beutler Lab
Gene Symbol Pld1
Ensembl Gene ENSMUSG00000027695
Gene Namephospholipase D1
SynonymsPld1a, Pld1b
MMRRC Submission 039693-MU
Accession Numbers

Genbank: NM_001164056; MGI: 109585

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1657 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location27938695-28133362 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28071187 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 417 (I417L)
Ref Sequence ENSEMBL: ENSMUSP00000113810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067757] [ENSMUST00000120834] [ENSMUST00000123539]
Predicted Effect probably benign
Transcript: ENSMUST00000067757
AA Change: I417L

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000064694
Gene: ENSMUSG00000027695
AA Change: I417L

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
PLDc 853 880 1.34e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120834
AA Change: I417L

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113810
Gene: ENSMUSG00000027695
AA Change: I417L

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
PLDc 853 880 1.34e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000123539
AA Change: I417L
SMART Domains Protein: ENSMUSP00000118727
Gene: ENSMUSG00000027695
AA Change: I417L

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131842
Predicted Effect unknown
Transcript: ENSMUST00000148827
AA Change: I228L
SMART Domains Protein: ENSMUSP00000120273
Gene: ENSMUSG00000027695
AA Change: I228L

DomainStartEndE-ValueType
PH 32 142 5.71e-9 SMART
PLDc 271 298 6.6e-6 SMART
low complexity region 315 329 N/A INTRINSIC
low complexity region 387 401 N/A INTRINSIC
PLDc 665 715 2.5e1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylcholine-specific phospholipase which catalyzes the hydrolysis of phosphatidylcholine in order to yield phosphatidic acid and choline. The enzyme may play a role in signal transduction and subcellular trafficking. Alternative splicing results in multiple transcript variants with both catalytic and regulatory properties. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a null allele show reduced tumor growth and angiogenesis. Homozygotes for a second null allele show abnormal hepatic autophagy after food restriction. Homozygotes for a third null allele show altered platelet activation and protection from thrombosis and ischemic brain injury. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,678 Q131R probably benign Het
3632451O06Rik G C 14: 49,773,560 T230S probably damaging Het
Acaca T G 11: 84,264,084 D988E probably benign Het
Als2 A G 1: 59,180,601 V1185A probably damaging Het
Amdhd2 A G 17: 24,156,055 V391A probably damaging Het
Caprin1 A T 2: 103,769,506 V608E probably damaging Het
Celsr3 T A 9: 108,842,952 C2512* probably null Het
Cfl1 A T 19: 5,493,555 R187W probably damaging Het
Cgnl1 C T 9: 71,725,944 V42I probably damaging Het
Chd2 A G 7: 73,480,430 Y826H probably damaging Het
Col9a2 C A 4: 121,040,974 P28T unknown Het
Cyp3a44 G A 5: 145,779,743 P346S probably damaging Het
Dact2 A G 17: 14,197,990 V151A probably benign Het
Dhx29 T C 13: 112,952,843 I716T probably damaging Het
Esam T C 9: 37,537,621 S342P probably damaging Het
Fam189a2 C A 19: 23,975,635 C437F probably damaging Het
Fer1l4 A G 2: 156,035,598 V1053A possibly damaging Het
Grk3 A G 5: 112,966,982 F124S probably damaging Het
H2-DMa G A 17: 34,137,399 probably null Het
Hsd3b5 T A 3: 98,619,720 I137F possibly damaging Het
Itgav A T 2: 83,801,779 I902F probably benign Het
Itsn1 G T 16: 91,909,223 C179F probably damaging Het
Kcnh8 G A 17: 52,839,125 R347H probably damaging Het
Kif9 T C 9: 110,489,966 M166T possibly damaging Het
Kmt5c C T 7: 4,746,454 Q324* probably null Het
Lcn9 G A 2: 25,824,710 E154K probably benign Het
Mfge8 A T 7: 79,141,773 L227Q probably benign Het
Mroh2b A T 15: 4,931,043 R753* probably null Het
Mtif2 G A 11: 29,540,721 R475Q probably benign Het
Nln C T 13: 104,036,947 V584I possibly damaging Het
Nr2e3 T C 9: 59,948,767 E129G probably benign Het
Ocstamp T C 2: 165,397,516 D250G probably damaging Het
Olfr1065 A C 2: 86,445,218 L255V probably damaging Het
Olfr403 A T 11: 74,195,896 H131L probably damaging Het
Olfr503 T C 7: 108,545,377 I284T possibly damaging Het
Polr1a A T 6: 71,941,535 K692N probably damaging Het
Qsox2 A T 2: 26,220,747 Y152* probably null Het
Rpap1 T C 2: 119,783,778 D46G possibly damaging Het
Rpe65 A G 3: 159,614,448 T246A probably damaging Het
Scn5a T C 9: 119,562,380 D82G probably damaging Het
Sema3d A G 5: 12,584,974 E669G possibly damaging Het
Serpinb6c T C 13: 33,880,226 N282S probably benign Het
Snap47 A T 11: 59,428,770 S181T probably benign Het
Snx9 A C 17: 5,918,436 T336P possibly damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Terb1 A T 8: 104,488,491 D284E possibly damaging Het
Tmem266 C T 9: 55,418,008 A153V probably damaging Het
Ttn T C 2: 76,742,804 E25915G possibly damaging Het
Tubal3 A G 13: 3,933,011 T264A possibly damaging Het
Vldlr G A 19: 27,245,670 R747Q probably benign Het
Zc3h8 G T 2: 128,929,957 probably benign Het
Zfp184 C T 13: 21,959,273 T383M probably damaging Het
Zfp455 T C 13: 67,198,639 F38S possibly damaging Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp985 T A 4: 147,584,110 N478K probably benign Het
Other mutations in Pld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Pld1 APN 3 28045098 critical splice donor site probably null
IGL01090:Pld1 APN 3 28088667 missense probably benign 0.01
IGL01140:Pld1 APN 3 28078237 missense probably benign 0.01
IGL01646:Pld1 APN 3 28099664 missense probably damaging 1.00
IGL01830:Pld1 APN 3 28048004 splice site probably benign
IGL01946:Pld1 APN 3 28124617 missense probably damaging 1.00
IGL02139:Pld1 APN 3 28120812 missense probably damaging 0.98
IGL02189:Pld1 APN 3 28120783 missense probably benign 0.03
IGL02476:Pld1 APN 3 28048039 missense probably damaging 1.00
IGL02540:Pld1 APN 3 28029160 unclassified probably benign
IGL02649:Pld1 APN 3 28087229 missense probably damaging 0.98
IGL02720:Pld1 APN 3 28087262 missense probably damaging 1.00
IGL02831:Pld1 APN 3 28076425 missense probably damaging 0.99
IGL02953:Pld1 APN 3 28112247 missense probably benign 0.03
IGL03005:Pld1 APN 3 28087253 missense possibly damaging 0.78
IGL03251:Pld1 APN 3 28088665 missense probably benign 0.06
IGL03331:Pld1 APN 3 28085845 missense probably damaging 1.00
A9681:Pld1 UTSW 3 28085832 missense probably benign 0.01
IGL03134:Pld1 UTSW 3 28029167 missense probably benign 0.01
P0023:Pld1 UTSW 3 28048125 missense probably damaging 1.00
R0054:Pld1 UTSW 3 28095884 splice site probably benign
R0054:Pld1 UTSW 3 28095884 splice site probably benign
R0282:Pld1 UTSW 3 28078273 missense probably benign
R0372:Pld1 UTSW 3 28088638 splice site probably null
R0454:Pld1 UTSW 3 28124575 missense probably damaging 1.00
R0492:Pld1 UTSW 3 28109817 missense probably damaging 0.96
R0505:Pld1 UTSW 3 28120822 missense possibly damaging 0.69
R0667:Pld1 UTSW 3 28079178 splice site probably null
R0678:Pld1 UTSW 3 28120784 missense probably damaging 0.99
R0980:Pld1 UTSW 3 28124575 missense probably damaging 1.00
R1200:Pld1 UTSW 3 28049286 missense probably damaging 1.00
R1235:Pld1 UTSW 3 28028734 missense probably benign 0.05
R1670:Pld1 UTSW 3 28049240 missense probably benign 0.17
R1705:Pld1 UTSW 3 28071277 critical splice donor site probably null
R1815:Pld1 UTSW 3 28109768 missense probably benign 0.04
R2215:Pld1 UTSW 3 28078393 missense probably benign 0.16
R3435:Pld1 UTSW 3 28124623 missense probably benign 0.13
R3522:Pld1 UTSW 3 28031247 missense probably damaging 1.00
R4206:Pld1 UTSW 3 28120783 missense probably benign 0.03
R4553:Pld1 UTSW 3 28124702 missense probably benign
R4612:Pld1 UTSW 3 28131733 missense possibly damaging 0.92
R4623:Pld1 UTSW 3 28029244 missense probably benign 0.01
R4840:Pld1 UTSW 3 28076551 missense probably benign 0.10
R4869:Pld1 UTSW 3 28109802 missense possibly damaging 0.84
R4982:Pld1 UTSW 3 28031298 missense probably damaging 0.97
R5087:Pld1 UTSW 3 28124582 missense probably damaging 1.00
R5182:Pld1 UTSW 3 28045081 missense probably damaging 1.00
R5384:Pld1 UTSW 3 28025320 missense probably damaging 1.00
R6243:Pld1 UTSW 3 28095805 missense probably damaging 0.98
R6345:Pld1 UTSW 3 28130747 intron probably benign
R6692:Pld1 UTSW 3 28041199 missense probably benign 0.15
R6881:Pld1 UTSW 3 28078414 missense possibly damaging 0.77
R7197:Pld1 UTSW 3 28024252 missense probably damaging 1.00
R7267:Pld1 UTSW 3 28076401 missense probably damaging 1.00
R7284:Pld1 UTSW 3 28131733 missense possibly damaging 0.92
R7293:Pld1 UTSW 3 28087286 missense probably damaging 0.99
Z1088:Pld1 UTSW 3 28029243 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTTCAGGCATTGGTCTCTGCAC -3'
(R):5'- GCCACGGATGCAAAATAAAGGCTAC -3'

Sequencing Primer
(F):5'- tttttcctgactccacctcc -3'
(R):5'- GTATGTGTGAAATACCCATGCC -3'
Posted On2014-05-09