Incidental Mutation 'R1657:Sema3d'
ID186453
Institutional Source Beutler Lab
Gene Symbol Sema3d
Ensembl Gene ENSMUSG00000040254
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D
Synonyms4631426B19Rik
MMRRC Submission 039693-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1657 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location12383385-12588948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12584974 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 669 (E669G)
Ref Sequence ENSEMBL: ENSMUSP00000030868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030868]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030868
AA Change: E669G

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030868
Gene: ENSMUSG00000040254
AA Change: E669G

DomainStartEndE-ValueType
transmembrane domain 16 35 N/A INTRINSIC
Sema 70 515 2.97e-207 SMART
PSI 533 585 2.03e-13 SMART
IG 598 682 1.39e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195923
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin III family of secreted signaling proteins that are involved in axon guidance during neuronal development. The encoded protein contains an N-terminal Sema domain, an immunoglobulin like domain and a C-terminal basic domain. The protein encoded by this gene binds neuropilin and plays an important role in cardiovascular development. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit pulmonary vein connection to the right atrium and atrial septal defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,678 Q131R probably benign Het
3632451O06Rik G C 14: 49,773,560 T230S probably damaging Het
Acaca T G 11: 84,264,084 D988E probably benign Het
Als2 A G 1: 59,180,601 V1185A probably damaging Het
Amdhd2 A G 17: 24,156,055 V391A probably damaging Het
Caprin1 A T 2: 103,769,506 V608E probably damaging Het
Celsr3 T A 9: 108,842,952 C2512* probably null Het
Cfl1 A T 19: 5,493,555 R187W probably damaging Het
Cgnl1 C T 9: 71,725,944 V42I probably damaging Het
Chd2 A G 7: 73,480,430 Y826H probably damaging Het
Col9a2 C A 4: 121,040,974 P28T unknown Het
Cyp3a44 G A 5: 145,779,743 P346S probably damaging Het
Dact2 A G 17: 14,197,990 V151A probably benign Het
Dhx29 T C 13: 112,952,843 I716T probably damaging Het
Esam T C 9: 37,537,621 S342P probably damaging Het
Fam189a2 C A 19: 23,975,635 C437F probably damaging Het
Fer1l4 A G 2: 156,035,598 V1053A possibly damaging Het
Grk3 A G 5: 112,966,982 F124S probably damaging Het
H2-DMa G A 17: 34,137,399 probably null Het
Hsd3b5 T A 3: 98,619,720 I137F possibly damaging Het
Itgav A T 2: 83,801,779 I902F probably benign Het
Itsn1 G T 16: 91,909,223 C179F probably damaging Het
Kcnh8 G A 17: 52,839,125 R347H probably damaging Het
Kif9 T C 9: 110,489,966 M166T possibly damaging Het
Kmt5c C T 7: 4,746,454 Q324* probably null Het
Lcn9 G A 2: 25,824,710 E154K probably benign Het
Mfge8 A T 7: 79,141,773 L227Q probably benign Het
Mroh2b A T 15: 4,931,043 R753* probably null Het
Mtif2 G A 11: 29,540,721 R475Q probably benign Het
Nln C T 13: 104,036,947 V584I possibly damaging Het
Nr2e3 T C 9: 59,948,767 E129G probably benign Het
Ocstamp T C 2: 165,397,516 D250G probably damaging Het
Olfr1065 A C 2: 86,445,218 L255V probably damaging Het
Olfr403 A T 11: 74,195,896 H131L probably damaging Het
Olfr503 T C 7: 108,545,377 I284T possibly damaging Het
Pld1 A T 3: 28,071,187 I417L probably benign Het
Polr1a A T 6: 71,941,535 K692N probably damaging Het
Qsox2 A T 2: 26,220,747 Y152* probably null Het
Rpap1 T C 2: 119,783,778 D46G possibly damaging Het
Rpe65 A G 3: 159,614,448 T246A probably damaging Het
Scn5a T C 9: 119,562,380 D82G probably damaging Het
Serpinb6c T C 13: 33,880,226 N282S probably benign Het
Snap47 A T 11: 59,428,770 S181T probably benign Het
Snx9 A C 17: 5,918,436 T336P possibly damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Terb1 A T 8: 104,488,491 D284E possibly damaging Het
Tmem266 C T 9: 55,418,008 A153V probably damaging Het
Ttn T C 2: 76,742,804 E25915G possibly damaging Het
Tubal3 A G 13: 3,933,011 T264A possibly damaging Het
Vldlr G A 19: 27,245,670 R747Q probably benign Het
Zc3h8 G T 2: 128,929,957 probably benign Het
Zfp184 C T 13: 21,959,273 T383M probably damaging Het
Zfp455 T C 13: 67,198,639 F38S possibly damaging Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp985 T A 4: 147,584,110 N478K probably benign Het
Other mutations in Sema3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Sema3d APN 5 12563222 missense probably benign 0.01
IGL00582:Sema3d APN 5 12585195 missense probably damaging 1.00
IGL00661:Sema3d APN 5 12505839 missense probably damaging 1.00
IGL00780:Sema3d APN 5 12524326 missense probably damaging 1.00
IGL01531:Sema3d APN 5 12541080 missense probably benign
IGL01957:Sema3d APN 5 12563315 missense probably damaging 1.00
IGL02100:Sema3d APN 5 12584991 missense probably benign 0.29
IGL02676:Sema3d APN 5 12570978 missense probably benign 0.38
IGL02749:Sema3d APN 5 12563145 splice site probably benign
IGL02827:Sema3d APN 5 12585118 missense probably benign 0.04
IGL03325:Sema3d APN 5 12463222 missense probably damaging 0.99
R0050:Sema3d UTSW 5 12584953 missense probably benign 0.00
R0085:Sema3d UTSW 5 12570986 missense probably benign 0.00
R0095:Sema3d UTSW 5 12563347 missense probably damaging 1.00
R0157:Sema3d UTSW 5 12508137 missense possibly damaging 0.95
R0328:Sema3d UTSW 5 12448075 missense possibly damaging 0.48
R0924:Sema3d UTSW 5 12463216 missense possibly damaging 0.69
R0930:Sema3d UTSW 5 12463216 missense possibly damaging 0.69
R1609:Sema3d UTSW 5 12541056 missense probably damaging 1.00
R1669:Sema3d UTSW 5 12508084 splice site probably benign
R1795:Sema3d UTSW 5 12584887 missense probably benign 0.02
R1861:Sema3d UTSW 5 12497603 missense probably benign 0.00
R1889:Sema3d UTSW 5 12485021 splice site probably null
R1895:Sema3d UTSW 5 12573843 missense probably damaging 1.00
R1946:Sema3d UTSW 5 12573843 missense probably damaging 1.00
R1975:Sema3d UTSW 5 12563318 missense probably damaging 1.00
R1975:Sema3d UTSW 5 12584998 missense probably benign
R2117:Sema3d UTSW 5 12563273 missense probably benign
R2148:Sema3d UTSW 5 12484959 missense probably damaging 0.99
R2276:Sema3d UTSW 5 12542582 missense possibly damaging 0.63
R3761:Sema3d UTSW 5 12571037 missense probably damaging 1.00
R4063:Sema3d UTSW 5 12585124 missense probably benign 0.25
R4428:Sema3d UTSW 5 12448120 missense probably benign 0.32
R4903:Sema3d UTSW 5 12563158 missense probably benign 0.00
R4999:Sema3d UTSW 5 12508087 splice site probably null
R5000:Sema3d UTSW 5 12448038 missense probably benign 0.01
R5022:Sema3d UTSW 5 12584956 missense probably damaging 1.00
R5186:Sema3d UTSW 5 12584908 missense probably benign
R5584:Sema3d UTSW 5 12566008 missense possibly damaging 0.49
R5584:Sema3d UTSW 5 12570987 missense possibly damaging 0.73
R6270:Sema3d UTSW 5 12448107 missense probably benign
R6368:Sema3d UTSW 5 12571013 missense probably damaging 1.00
R6426:Sema3d UTSW 5 12563264 missense probably damaging 1.00
R6750:Sema3d UTSW 5 12585100 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCAGGTTATATCTTGGGGACTACTACC -3'
(R):5'- GTACTGGTCCAGGCTGAAGTTCG -3'

Sequencing Primer
(F):5'- tctttctttcttcctttcttccttc -3'
(R):5'- TCGGGCTGCTAAGGATTTG -3'
Posted On2014-05-09