Incidental Mutation 'R1657:Zfp746'
ID186457
Institutional Source Beutler Lab
Gene Symbol Zfp746
Ensembl Gene ENSMUSG00000057691
Gene Namezinc finger protein 746
Synonyms2810407L07Rik
MMRRC Submission 039693-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.330) question?
Stock #R1657 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location48062395-48086593 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48082174 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 167 (V167A)
Ref Sequence ENSEMBL: ENSMUSP00000072868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073124] [ENSMUST00000203609]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073124
AA Change: V167A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072868
Gene: ENSMUSG00000057691
AA Change: V167A

DomainStartEndE-ValueType
Pfam:DUF3669 11 81 3.4e-12 PFAM
KRAB 107 156 1.37e-12 SMART
low complexity region 168 183 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
ZnF_C2H2 454 474 3.65e1 SMART
low complexity region 481 511 N/A INTRINSIC
ZnF_C2H2 517 539 1.92e-2 SMART
ZnF_C2H2 545 567 1.82e-3 SMART
ZnF_C2H2 573 595 1.72e-4 SMART
low complexity region 601 623 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203609
AA Change: V167A

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000145506
Gene: ENSMUSG00000057691
AA Change: V167A

DomainStartEndE-ValueType
Pfam:DUF3669 11 81 4.6e-9 PFAM
KRAB 107 156 5.7e-15 SMART
low complexity region 168 183 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
ZnF_C2H2 453 473 1.6e-1 SMART
low complexity region 480 510 N/A INTRINSIC
ZnF_C2H2 516 538 8e-5 SMART
ZnF_C2H2 544 566 7.8e-6 SMART
ZnF_C2H2 572 594 7.3e-7 SMART
low complexity region 600 622 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204771
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,678 Q131R probably benign Het
3632451O06Rik G C 14: 49,773,560 T230S probably damaging Het
Acaca T G 11: 84,264,084 D988E probably benign Het
Als2 A G 1: 59,180,601 V1185A probably damaging Het
Amdhd2 A G 17: 24,156,055 V391A probably damaging Het
Caprin1 A T 2: 103,769,506 V608E probably damaging Het
Celsr3 T A 9: 108,842,952 C2512* probably null Het
Cfl1 A T 19: 5,493,555 R187W probably damaging Het
Cgnl1 C T 9: 71,725,944 V42I probably damaging Het
Chd2 A G 7: 73,480,430 Y826H probably damaging Het
Col9a2 C A 4: 121,040,974 P28T unknown Het
Cyp3a44 G A 5: 145,779,743 P346S probably damaging Het
Dact2 A G 17: 14,197,990 V151A probably benign Het
Dhx29 T C 13: 112,952,843 I716T probably damaging Het
Esam T C 9: 37,537,621 S342P probably damaging Het
Fam189a2 C A 19: 23,975,635 C437F probably damaging Het
Fer1l4 A G 2: 156,035,598 V1053A possibly damaging Het
Grk3 A G 5: 112,966,982 F124S probably damaging Het
H2-DMa G A 17: 34,137,399 probably null Het
Hsd3b5 T A 3: 98,619,720 I137F possibly damaging Het
Itgav A T 2: 83,801,779 I902F probably benign Het
Itsn1 G T 16: 91,909,223 C179F probably damaging Het
Kcnh8 G A 17: 52,839,125 R347H probably damaging Het
Kif9 T C 9: 110,489,966 M166T possibly damaging Het
Kmt5c C T 7: 4,746,454 Q324* probably null Het
Lcn9 G A 2: 25,824,710 E154K probably benign Het
Mfge8 A T 7: 79,141,773 L227Q probably benign Het
Mroh2b A T 15: 4,931,043 R753* probably null Het
Mtif2 G A 11: 29,540,721 R475Q probably benign Het
Nln C T 13: 104,036,947 V584I possibly damaging Het
Nr2e3 T C 9: 59,948,767 E129G probably benign Het
Ocstamp T C 2: 165,397,516 D250G probably damaging Het
Olfr1065 A C 2: 86,445,218 L255V probably damaging Het
Olfr403 A T 11: 74,195,896 H131L probably damaging Het
Olfr503 T C 7: 108,545,377 I284T possibly damaging Het
Pld1 A T 3: 28,071,187 I417L probably benign Het
Polr1a A T 6: 71,941,535 K692N probably damaging Het
Qsox2 A T 2: 26,220,747 Y152* probably null Het
Rpap1 T C 2: 119,783,778 D46G possibly damaging Het
Rpe65 A G 3: 159,614,448 T246A probably damaging Het
Scn5a T C 9: 119,562,380 D82G probably damaging Het
Sema3d A G 5: 12,584,974 E669G possibly damaging Het
Serpinb6c T C 13: 33,880,226 N282S probably benign Het
Snap47 A T 11: 59,428,770 S181T probably benign Het
Snx9 A C 17: 5,918,436 T336P possibly damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Terb1 A T 8: 104,488,491 D284E possibly damaging Het
Tmem266 C T 9: 55,418,008 A153V probably damaging Het
Ttn T C 2: 76,742,804 E25915G possibly damaging Het
Tubal3 A G 13: 3,933,011 T264A possibly damaging Het
Vldlr G A 19: 27,245,670 R747Q probably benign Het
Zc3h8 G T 2: 128,929,957 probably benign Het
Zfp184 C T 13: 21,959,273 T383M probably damaging Het
Zfp455 T C 13: 67,198,639 F38S possibly damaging Het
Zfp985 T A 4: 147,584,110 N478K probably benign Het
Other mutations in Zfp746
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01993:Zfp746 APN 6 48082158 missense probably damaging 0.99
R0020:Zfp746 UTSW 6 48064707 missense probably benign 0.05
R0020:Zfp746 UTSW 6 48064707 missense probably benign 0.05
R0734:Zfp746 UTSW 6 48064899 missense probably damaging 0.97
R1109:Zfp746 UTSW 6 48064922 missense possibly damaging 0.94
R1656:Zfp746 UTSW 6 48064477 missense probably damaging 0.99
R2474:Zfp746 UTSW 6 48064769 missense probably damaging 1.00
R4748:Zfp746 UTSW 6 48064556 missense probably benign 0.05
R5168:Zfp746 UTSW 6 48064395 missense possibly damaging 0.88
R5386:Zfp746 UTSW 6 48064176 missense possibly damaging 0.94
R5446:Zfp746 UTSW 6 48064173 missense probably damaging 0.97
R5560:Zfp746 UTSW 6 48082174 missense possibly damaging 0.94
R7251:Zfp746 UTSW 6 48064877 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATGACTCCTTGCACAGTTCG -3'
(R):5'- TACAAATGCCTGCCCCAGCTTC -3'

Sequencing Primer
(F):5'- CTCCTTGCACAGTTCGGAATAAG -3'
(R):5'- CCCCAGCTTCTGATGAGAATG -3'
Posted On2014-05-09