Incidental Mutation 'R1657:Mfge8'
ID186461
Institutional Source Beutler Lab
Gene Symbol Mfge8
Ensembl Gene ENSMUSG00000030605
Gene Namemilk fat globule-EGF factor 8 protein
SynonymsMFG-E8, Mfgm, EGF/factor VIII, lactadherin, SED1
MMRRC Submission 039693-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.466) question?
Stock #R1657 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location79133768-79149060 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79141773 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 227 (L227Q)
Ref Sequence ENSEMBL: ENSMUSP00000103032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032825] [ENSMUST00000107409] [ENSMUST00000205563]
Predicted Effect probably benign
Transcript: ENSMUST00000032825
AA Change: L264Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032825
Gene: ENSMUSG00000030605
AA Change: L264Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF 27 61 2.43e-4 SMART
EGF 67 108 1.41e-5 SMART
low complexity region 123 138 N/A INTRINSIC
FA58C 147 303 1.94e-43 SMART
FA58C 307 463 1.24e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107409
AA Change: L227Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103032
Gene: ENSMUSG00000030605
AA Change: L227Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF 27 61 2.43e-4 SMART
EGF 67 108 1.41e-5 SMART
FA58C 110 266 3.68e-44 SMART
FA58C 270 426 1.24e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205526
Predicted Effect probably benign
Transcript: ENSMUST00000205563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206844
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a preproprotein that is proteolytically processed to form multiple protein products. The major encoded protein product, lactadherin, is a membrane glycoprotein that promotes phagocytosis of apoptotic cells. This protein has also been implicated in wound healing, autoimmune disease, and cancer. Lactadherin can be further processed to form a smaller cleavage product, medin, which comprises the major protein component of aortic medial amyloid (AMA). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced male fertility associated with impaired zona pellucida binding. Fertility is unaffected in female mutant mice. Splenomegaly occurs with age and defects occur in phagocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,678 Q131R probably benign Het
3632451O06Rik G C 14: 49,773,560 T230S probably damaging Het
Acaca T G 11: 84,264,084 D988E probably benign Het
Als2 A G 1: 59,180,601 V1185A probably damaging Het
Amdhd2 A G 17: 24,156,055 V391A probably damaging Het
Caprin1 A T 2: 103,769,506 V608E probably damaging Het
Celsr3 T A 9: 108,842,952 C2512* probably null Het
Cfl1 A T 19: 5,493,555 R187W probably damaging Het
Cgnl1 C T 9: 71,725,944 V42I probably damaging Het
Chd2 A G 7: 73,480,430 Y826H probably damaging Het
Col9a2 C A 4: 121,040,974 P28T unknown Het
Cyp3a44 G A 5: 145,779,743 P346S probably damaging Het
Dact2 A G 17: 14,197,990 V151A probably benign Het
Dhx29 T C 13: 112,952,843 I716T probably damaging Het
Esam T C 9: 37,537,621 S342P probably damaging Het
Fam189a2 C A 19: 23,975,635 C437F probably damaging Het
Fer1l4 A G 2: 156,035,598 V1053A possibly damaging Het
Grk3 A G 5: 112,966,982 F124S probably damaging Het
H2-DMa G A 17: 34,137,399 probably null Het
Hsd3b5 T A 3: 98,619,720 I137F possibly damaging Het
Itgav A T 2: 83,801,779 I902F probably benign Het
Itsn1 G T 16: 91,909,223 C179F probably damaging Het
Kcnh8 G A 17: 52,839,125 R347H probably damaging Het
Kif9 T C 9: 110,489,966 M166T possibly damaging Het
Kmt5c C T 7: 4,746,454 Q324* probably null Het
Lcn9 G A 2: 25,824,710 E154K probably benign Het
Mroh2b A T 15: 4,931,043 R753* probably null Het
Mtif2 G A 11: 29,540,721 R475Q probably benign Het
Nln C T 13: 104,036,947 V584I possibly damaging Het
Nr2e3 T C 9: 59,948,767 E129G probably benign Het
Ocstamp T C 2: 165,397,516 D250G probably damaging Het
Olfr1065 A C 2: 86,445,218 L255V probably damaging Het
Olfr403 A T 11: 74,195,896 H131L probably damaging Het
Olfr503 T C 7: 108,545,377 I284T possibly damaging Het
Pld1 A T 3: 28,071,187 I417L probably benign Het
Polr1a A T 6: 71,941,535 K692N probably damaging Het
Qsox2 A T 2: 26,220,747 Y152* probably null Het
Rpap1 T C 2: 119,783,778 D46G possibly damaging Het
Rpe65 A G 3: 159,614,448 T246A probably damaging Het
Scn5a T C 9: 119,562,380 D82G probably damaging Het
Sema3d A G 5: 12,584,974 E669G possibly damaging Het
Serpinb6c T C 13: 33,880,226 N282S probably benign Het
Snap47 A T 11: 59,428,770 S181T probably benign Het
Snx9 A C 17: 5,918,436 T336P possibly damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Terb1 A T 8: 104,488,491 D284E possibly damaging Het
Tmem266 C T 9: 55,418,008 A153V probably damaging Het
Ttn T C 2: 76,742,804 E25915G possibly damaging Het
Tubal3 A G 13: 3,933,011 T264A possibly damaging Het
Vldlr G A 19: 27,245,670 R747Q probably benign Het
Zc3h8 G T 2: 128,929,957 probably benign Het
Zfp184 C T 13: 21,959,273 T383M probably damaging Het
Zfp455 T C 13: 67,198,639 F38S possibly damaging Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp985 T A 4: 147,584,110 N478K probably benign Het
Other mutations in Mfge8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Mfge8 APN 7 79136782 missense probably damaging 1.00
IGL01751:Mfge8 APN 7 79136655 critical splice donor site probably null
IGL02023:Mfge8 APN 7 79145237 intron probably benign
IGL02112:Mfge8 APN 7 79143340 missense probably benign
IGL02669:Mfge8 APN 7 79145681 missense probably benign 0.36
IGL02978:Mfge8 APN 7 79141710 missense probably damaging 1.00
IGL02978:Mfge8 APN 7 79141728 missense possibly damaging 0.92
R1587:Mfge8 UTSW 7 79134765 missense probably damaging 1.00
R1716:Mfge8 UTSW 7 79142443 missense probably damaging 1.00
R4766:Mfge8 UTSW 7 79134525 missense probably damaging 1.00
R5100:Mfge8 UTSW 7 79143300 missense probably benign 0.13
R6932:Mfge8 UTSW 7 79143301 missense probably benign
R7044:Mfge8 UTSW 7 79142520 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GGCAGACAGCACATAACTGGAACTC -3'
(R):5'- GGTGACAGGGACACTGTTCTGATG -3'

Sequencing Primer
(F):5'- TAACTGGAACTCCCAGGCG -3'
(R):5'- ACACTGTTCTGATGGTGGTGG -3'
Posted On2014-05-09