Incidental Mutation 'R1657:Terb1'
ID186464
Institutional Source Beutler Lab
Gene Symbol Terb1
Ensembl Gene ENSMUSG00000052616
Gene Nametelomere repeat binding bouquet formation protein 1
SynonymsCcdc79, 4930532D21Rik
MMRRC Submission 039693-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1657 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location104446719-104509910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104488491 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 284 (D284E)
Ref Sequence ENSEMBL: ENSMUSP00000067324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064576] [ENSMUST00000159713] [ENSMUST00000161520]
PDB Structure
Solution structures of the myb-like DNA binding domain of 4930532D21Rik protein [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064576
AA Change: D284E

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000067324
Gene: ENSMUSG00000052616
AA Change: D284E

DomainStartEndE-ValueType
SCOP:d1ee4a_ 2 368 7e-11 SMART
low complexity region 416 428 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
SANT 711 762 7.07e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159713
AA Change: D284E

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000124706
Gene: ENSMUSG00000052616
AA Change: D284E

DomainStartEndE-ValueType
SCOP:d1qgra_ 10 335 6e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161520
AA Change: D284E

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125431
Gene: ENSMUSG00000052616
AA Change: D284E

DomainStartEndE-ValueType
SCOP:d1qgra_ 10 336 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162014
SMART Domains Protein: ENSMUSP00000123925
Gene: ENSMUSG00000052616

DomainStartEndE-ValueType
SCOP:d1jdha_ 21 370 7e-8 SMART
low complexity region 382 394 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
low complexity region 688 695 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male and female mice homozygous for a null allele are infertile with arrest of meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,678 Q131R probably benign Het
3632451O06Rik G C 14: 49,773,560 T230S probably damaging Het
Acaca T G 11: 84,264,084 D988E probably benign Het
Als2 A G 1: 59,180,601 V1185A probably damaging Het
Amdhd2 A G 17: 24,156,055 V391A probably damaging Het
Caprin1 A T 2: 103,769,506 V608E probably damaging Het
Celsr3 T A 9: 108,842,952 C2512* probably null Het
Cfl1 A T 19: 5,493,555 R187W probably damaging Het
Cgnl1 C T 9: 71,725,944 V42I probably damaging Het
Chd2 A G 7: 73,480,430 Y826H probably damaging Het
Col9a2 C A 4: 121,040,974 P28T unknown Het
Cyp3a44 G A 5: 145,779,743 P346S probably damaging Het
Dact2 A G 17: 14,197,990 V151A probably benign Het
Dhx29 T C 13: 112,952,843 I716T probably damaging Het
Esam T C 9: 37,537,621 S342P probably damaging Het
Fam189a2 C A 19: 23,975,635 C437F probably damaging Het
Fer1l4 A G 2: 156,035,598 V1053A possibly damaging Het
Grk3 A G 5: 112,966,982 F124S probably damaging Het
H2-DMa G A 17: 34,137,399 probably null Het
Hsd3b5 T A 3: 98,619,720 I137F possibly damaging Het
Itgav A T 2: 83,801,779 I902F probably benign Het
Itsn1 G T 16: 91,909,223 C179F probably damaging Het
Kcnh8 G A 17: 52,839,125 R347H probably damaging Het
Kif9 T C 9: 110,489,966 M166T possibly damaging Het
Kmt5c C T 7: 4,746,454 Q324* probably null Het
Lcn9 G A 2: 25,824,710 E154K probably benign Het
Mfge8 A T 7: 79,141,773 L227Q probably benign Het
Mroh2b A T 15: 4,931,043 R753* probably null Het
Mtif2 G A 11: 29,540,721 R475Q probably benign Het
Nln C T 13: 104,036,947 V584I possibly damaging Het
Nr2e3 T C 9: 59,948,767 E129G probably benign Het
Ocstamp T C 2: 165,397,516 D250G probably damaging Het
Olfr1065 A C 2: 86,445,218 L255V probably damaging Het
Olfr403 A T 11: 74,195,896 H131L probably damaging Het
Olfr503 T C 7: 108,545,377 I284T possibly damaging Het
Pld1 A T 3: 28,071,187 I417L probably benign Het
Polr1a A T 6: 71,941,535 K692N probably damaging Het
Qsox2 A T 2: 26,220,747 Y152* probably null Het
Rpap1 T C 2: 119,783,778 D46G possibly damaging Het
Rpe65 A G 3: 159,614,448 T246A probably damaging Het
Scn5a T C 9: 119,562,380 D82G probably damaging Het
Sema3d A G 5: 12,584,974 E669G possibly damaging Het
Serpinb6c T C 13: 33,880,226 N282S probably benign Het
Snap47 A T 11: 59,428,770 S181T probably benign Het
Snx9 A C 17: 5,918,436 T336P possibly damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Tmem266 C T 9: 55,418,008 A153V probably damaging Het
Ttn T C 2: 76,742,804 E25915G possibly damaging Het
Tubal3 A G 13: 3,933,011 T264A possibly damaging Het
Vldlr G A 19: 27,245,670 R747Q probably benign Het
Zc3h8 G T 2: 128,929,957 probably benign Het
Zfp184 C T 13: 21,959,273 T383M probably damaging Het
Zfp455 T C 13: 67,198,639 F38S possibly damaging Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp985 T A 4: 147,584,110 N478K probably benign Het
Other mutations in Terb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Terb1 APN 8 104451807 missense probably benign 0.09
IGL01468:Terb1 APN 8 104482167 intron probably benign
IGL01619:Terb1 APN 8 104473014 missense probably benign 0.00
IGL01631:Terb1 APN 8 104472864 missense probably damaging 0.99
IGL02041:Terb1 APN 8 104495114 missense probably damaging 1.00
IGL02413:Terb1 APN 8 104494868 critical splice donor site probably null
IGL02974:Terb1 APN 8 104494968 nonsense probably null
IGL03091:Terb1 APN 8 104469154 missense probably benign 0.03
IGL03410:Terb1 APN 8 104473042 splice site probably benign
R0825:Terb1 UTSW 8 104468748 missense possibly damaging 0.65
R0906:Terb1 UTSW 8 104452636 missense probably damaging 1.00
R1175:Terb1 UTSW 8 104484306 missense probably benign 0.07
R1494:Terb1 UTSW 8 104498490 splice site probably benign
R2018:Terb1 UTSW 8 104452699 missense probably benign 0.00
R2029:Terb1 UTSW 8 104498100 splice site probably benign
R2047:Terb1 UTSW 8 104485462 missense probably damaging 1.00
R2062:Terb1 UTSW 8 104468748 missense possibly damaging 0.65
R2179:Terb1 UTSW 8 104452715 missense probably damaging 0.99
R2179:Terb1 UTSW 8 104472737 missense probably benign 0.08
R2187:Terb1 UTSW 8 104472884 missense probably benign
R2420:Terb1 UTSW 8 104498595 missense probably damaging 1.00
R2867:Terb1 UTSW 8 104447853 unclassified probably benign
R3749:Terb1 UTSW 8 104496834 missense probably damaging 1.00
R4850:Terb1 UTSW 8 104485425 missense probably benign 0.02
R4930:Terb1 UTSW 8 104447948 missense probably benign 0.00
R4963:Terb1 UTSW 8 104482318 missense probably damaging 1.00
R4969:Terb1 UTSW 8 104495163 missense probably benign 0.00
R5100:Terb1 UTSW 8 104495173 nonsense probably null
R5440:Terb1 UTSW 8 104488499 missense probably damaging 1.00
R5824:Terb1 UTSW 8 104485447 missense probably benign 0.08
R5950:Terb1 UTSW 8 104488485 critical splice donor site probably null
R5985:Terb1 UTSW 8 104451807 missense probably benign 0.09
R5985:Terb1 UTSW 8 104482316 missense probably damaging 1.00
R6320:Terb1 UTSW 8 104447199 missense probably damaging 1.00
R6432:Terb1 UTSW 8 104485446 missense possibly damaging 0.65
R6473:Terb1 UTSW 8 104473037 missense probably damaging 1.00
R6701:Terb1 UTSW 8 104472756 missense possibly damaging 0.69
R7013:Terb1 UTSW 8 104488590 nonsense probably null
R7064:Terb1 UTSW 8 104488554 missense probably benign 0.00
R7237:Terb1 UTSW 8 104495327 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGAGGGTCCATAGCAGGCACCA -3'
(R):5'- GCACACGCTCAGAACTGCTTTGT -3'

Sequencing Primer
(F):5'- cccacccactcccacttc -3'
(R):5'- AGAACTGCTTTGTCTCTTCGG -3'
Posted On2014-05-09